Incidental Mutation 'R7581:Creb5'
ID 586740
Institutional Source Beutler Lab
Gene Symbol Creb5
Ensembl Gene ENSMUSG00000053007
Gene Name cAMP responsive element binding protein 5
Synonyms Crebpa, D430026C09Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R7581 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 53287270-53700376 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 53681237 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 184 (L184P)
Ref Sequence ENSEMBL: ENSMUSP00000144719 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047450] [ENSMUST00000203487] [ENSMUST00000203528] [ENSMUST00000205120]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000047450
AA Change: L328P

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000038532
Gene: ENSMUSG00000053007
AA Change: L328P

DomainStartEndE-ValueType
low complexity region 117 178 N/A INTRINSIC
low complexity region 196 211 N/A INTRINSIC
BRLZ 222 286 1.91e-20 SMART
low complexity region 304 318 N/A INTRINSIC
low complexity region 329 344 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000203487
AA Change: L335P

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000144851
Gene: ENSMUSG00000053007
AA Change: L335P

DomainStartEndE-ValueType
ZnF_C2H2 16 40 7.9e-5 SMART
low complexity region 268 329 N/A INTRINSIC
low complexity region 347 362 N/A INTRINSIC
BRLZ 373 437 8e-23 SMART
low complexity region 455 469 N/A INTRINSIC
low complexity region 480 495 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000203528
AA Change: L328P

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000144979
Gene: ENSMUSG00000053007
AA Change: L328P

DomainStartEndE-ValueType
ZnF_C2H2 9 33 7.9e-5 SMART
low complexity region 261 322 N/A INTRINSIC
low complexity region 340 355 N/A INTRINSIC
BRLZ 366 430 8e-23 SMART
low complexity region 448 462 N/A INTRINSIC
low complexity region 473 488 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000205120
AA Change: L184P

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000144719
Gene: ENSMUSG00000053007
AA Change: L184P

DomainStartEndE-ValueType
low complexity region 117 178 N/A INTRINSIC
low complexity region 196 211 N/A INTRINSIC
BRLZ 222 286 1.91e-20 SMART
low complexity region 304 318 N/A INTRINSIC
low complexity region 329 344 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 98% (47/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene belongs to the CRE (cAMP response element)-binding protein family. Members of this family contain zinc-finger and bZIP DNA-binding domains. The encoded protein specifically binds to CRE as a homodimer or a heterodimer with c-Jun or CRE-BP1, and functions as a CRE-dependent trans-activator. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation display neonatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430403G16Rik G A 5: 109,690,788 probably benign Het
Adamts9 A C 6: 92,937,338 D196E probably benign Het
Adnp A T 2: 168,183,466 D636E probably damaging Het
Afdn T C 17: 13,849,238 V723A probably damaging Het
Arid1a A T 4: 133,680,351 F1897I unknown Het
Atp6v0b T C 4: 117,885,286 M137V probably benign Het
Bicd1 T A 6: 149,519,004 I784N probably damaging Het
Cckbr A G 7: 105,433,786 T119A probably benign Het
Cyp2a22 T G 7: 26,938,148 K141Q possibly damaging Het
D16Ertd472e T C 16: 78,546,557 T219A possibly damaging Het
Ep400 A T 5: 110,756,025 L236Q unknown Het
Exph5 A G 9: 53,372,557 S313G possibly damaging Het
Gm10024 T C 10: 77,711,563 V36A unknown Het
Gm5493 A G 17: 22,747,274 E44G probably damaging Het
Gtdc1 A T 2: 44,790,005 probably null Het
Invs T C 4: 48,421,909 V847A probably benign Het
Kif18b C A 11: 102,914,722 Q236H probably damaging Het
Kntc1 A G 5: 123,816,755 T2079A probably benign Het
Large2 A G 2: 92,370,193 S89P probably damaging Het
Maml3 A C 3: 51,856,768 D258E probably benign Het
Mdga2 A T 12: 66,506,255 M868K probably damaging Het
Mtss1l A G 8: 110,726,213 E30G possibly damaging Het
Muc16 T C 9: 18,645,614 I3128V unknown Het
Mug2 C T 6: 122,063,711 T740I probably damaging Het
Noc2l T C 4: 156,245,449 V612A probably benign Het
Olfr420 G A 1: 174,158,771 probably null Het
Olfr979 A T 9: 40,000,422 D268E probably damaging Het
Padi6 T C 4: 140,728,929 T585A probably benign Het
Pcdhga1 A T 18: 37,662,177 N78I probably damaging Het
Pdgfd A G 9: 6,293,894 Y156C probably damaging Het
Peg10 GCACATCAGGATCC GCACATCAGGATCCCCATCAGGATCCTCCACATCAGGATCC 6: 4,756,452 probably benign Het
Pi4ka C T 16: 17,301,060 V1307I Het
Pip5k1c A G 10: 81,308,960 N212D probably damaging Het
Plekha1 A G 7: 130,910,865 T264A probably benign Het
Polr2b A G 5: 77,326,704 R463G probably damaging Het
Psd2 T G 18: 35,979,997 D248E probably benign Het
Rag1 G T 2: 101,643,304 Q498K possibly damaging Het
Ryr3 A G 2: 112,753,027 I2853T probably damaging Het
Selenow G T 7: 15,922,382 probably null Het
Sned1 C T 1: 93,256,545 S165F probably benign Het
Spata31d1a A G 13: 59,704,139 probably null Het
Taar4 C A 10: 23,961,154 H221N probably damaging Het
Tgm6 A T 2: 130,141,285 R265W probably damaging Het
Trpm1 A T 7: 64,204,555 Q275L probably benign Het
Ulk3 T C 9: 57,592,042 L173P probably damaging Het
Urah A T 7: 140,835,627 T3S probably benign Het
Vmn1r149 A T 7: 22,437,904 V109D probably damaging Het
Xpc A T 6: 91,498,017 probably benign Het
Zglp1 T A 9: 21,062,708 K227N probably damaging Het
Other mutations in Creb5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02114:Creb5 APN 6 53604458 splice site probably benign
IGL02475:Creb5 APN 6 53693924 missense probably damaging 0.98
IGL02663:Creb5 APN 6 53680961 missense probably damaging 0.99
R0054:Creb5 UTSW 6 53447657 missense probably benign 0.27
R0452:Creb5 UTSW 6 53604542 missense possibly damaging 0.94
R4580:Creb5 UTSW 6 53604534 missense possibly damaging 0.46
R4809:Creb5 UTSW 6 53610426 missense probably null 0.71
R4957:Creb5 UTSW 6 53693922 critical splice acceptor site probably null
R5375:Creb5 UTSW 6 53681017 missense possibly damaging 0.79
R6552:Creb5 UTSW 6 53685384 missense probably damaging 0.99
R6616:Creb5 UTSW 6 53685310 missense possibly damaging 0.96
R6679:Creb5 UTSW 6 53685469 missense possibly damaging 0.51
R6745:Creb5 UTSW 6 53604532 missense probably benign 0.03
R7428:Creb5 UTSW 6 53681158 missense unknown
X0065:Creb5 UTSW 6 53685401 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- ACATGATGGAGATGATGGGCTC -3'
(R):5'- TGACAGTTCACAATCACCTCCTAG -3'

Sequencing Primer
(F):5'- ATGATGGGCTCCCGGCAAG -3'
(R):5'- CTAGGAAATGCACAGAGCTCCTTTAG -3'
Posted On 2019-10-24