Incidental Mutation 'R7581:Mug2'
ID 586742
Institutional Source Beutler Lab
Gene Symbol Mug2
Ensembl Gene ENSMUSG00000030131
Gene Name murinoglobulin 2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.050) question?
Stock # R7581 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 122006761-122085965 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 122063711 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 740 (T740I)
Ref Sequence ENSEMBL: ENSMUSP00000080469 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081777]
AlphaFold P28666
Predicted Effect probably damaging
Transcript: ENSMUST00000081777
AA Change: T740I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000080469
Gene: ENSMUSG00000030131
AA Change: T740I

DomainStartEndE-ValueType
Pfam:A2M_N 128 221 3.5e-21 PFAM
A2M_N_2 449 599 1.05e-42 SMART
low complexity region 711 728 N/A INTRINSIC
A2M 740 830 7.16e-36 SMART
Pfam:Thiol-ester_cl 963 992 1e-18 PFAM
low complexity region 994 1005 N/A INTRINSIC
Pfam:A2M_comp 1012 1097 5.8e-34 PFAM
Pfam:A2M_comp 1093 1243 3e-47 PFAM
A2M_recep 1353 1440 1.85e-38 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 98% (47/48)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430403G16Rik G A 5: 109,690,788 probably benign Het
Adamts9 A C 6: 92,937,338 D196E probably benign Het
Adnp A T 2: 168,183,466 D636E probably damaging Het
Afdn T C 17: 13,849,238 V723A probably damaging Het
Arid1a A T 4: 133,680,351 F1897I unknown Het
Atp6v0b T C 4: 117,885,286 M137V probably benign Het
Bicd1 T A 6: 149,519,004 I784N probably damaging Het
Cckbr A G 7: 105,433,786 T119A probably benign Het
Creb5 T C 6: 53,681,237 L184P probably damaging Het
Cyp2a22 T G 7: 26,938,148 K141Q possibly damaging Het
D16Ertd472e T C 16: 78,546,557 T219A possibly damaging Het
Ep400 A T 5: 110,756,025 L236Q unknown Het
Exph5 A G 9: 53,372,557 S313G possibly damaging Het
Gm10024 T C 10: 77,711,563 V36A unknown Het
Gm5493 A G 17: 22,747,274 E44G probably damaging Het
Gtdc1 A T 2: 44,790,005 probably null Het
Invs T C 4: 48,421,909 V847A probably benign Het
Kif18b C A 11: 102,914,722 Q236H probably damaging Het
Kntc1 A G 5: 123,816,755 T2079A probably benign Het
Large2 A G 2: 92,370,193 S89P probably damaging Het
Maml3 A C 3: 51,856,768 D258E probably benign Het
Mdga2 A T 12: 66,506,255 M868K probably damaging Het
Mtss1l A G 8: 110,726,213 E30G possibly damaging Het
Muc16 T C 9: 18,645,614 I3128V unknown Het
Noc2l T C 4: 156,245,449 V612A probably benign Het
Olfr420 G A 1: 174,158,771 probably null Het
Olfr979 A T 9: 40,000,422 D268E probably damaging Het
Padi6 T C 4: 140,728,929 T585A probably benign Het
Pcdhga1 A T 18: 37,662,177 N78I probably damaging Het
Pdgfd A G 9: 6,293,894 Y156C probably damaging Het
Peg10 GCACATCAGGATCC GCACATCAGGATCCCCATCAGGATCCTCCACATCAGGATCC 6: 4,756,452 probably benign Het
Pi4ka C T 16: 17,301,060 V1307I Het
Pip5k1c A G 10: 81,308,960 N212D probably damaging Het
Plekha1 A G 7: 130,910,865 T264A probably benign Het
Polr2b A G 5: 77,326,704 R463G probably damaging Het
Psd2 T G 18: 35,979,997 D248E probably benign Het
Rag1 G T 2: 101,643,304 Q498K possibly damaging Het
Ryr3 A G 2: 112,753,027 I2853T probably damaging Het
Selenow G T 7: 15,922,382 probably null Het
Sned1 C T 1: 93,256,545 S165F probably benign Het
Spata31d1a A G 13: 59,704,139 probably null Het
Taar4 C A 10: 23,961,154 H221N probably damaging Het
Tgm6 A T 2: 130,141,285 R265W probably damaging Het
Trpm1 A T 7: 64,204,555 Q275L probably benign Het
Ulk3 T C 9: 57,592,042 L173P probably damaging Het
Urah A T 7: 140,835,627 T3S probably benign Het
Vmn1r149 A T 7: 22,437,904 V109D probably damaging Het
Xpc A T 6: 91,498,017 probably benign Het
Zglp1 T A 9: 21,062,708 K227N probably damaging Het
Other mutations in Mug2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00708:Mug2 APN 6 122047487 missense possibly damaging 0.83
IGL00957:Mug2 APN 6 122040654 missense probably damaging 0.99
IGL01314:Mug2 APN 6 122081279 missense possibly damaging 0.62
IGL01338:Mug2 APN 6 122049628 splice site probably benign
IGL01477:Mug2 APN 6 122081684 splice site probably benign
IGL01926:Mug2 APN 6 122036104 splice site probably benign
IGL02019:Mug2 APN 6 122047435 missense probably benign 0.02
IGL02305:Mug2 APN 6 122036056 missense probably benign
IGL02310:Mug2 APN 6 122059123 splice site probably benign
IGL02484:Mug2 APN 6 122072753 missense probably damaging 1.00
IGL02516:Mug2 APN 6 122070843 missense probably damaging 1.00
IGL02531:Mug2 APN 6 122072771 missense probably damaging 1.00
IGL02666:Mug2 APN 6 122081326 missense probably damaging 1.00
IGL02936:Mug2 APN 6 122081387 critical splice donor site probably null
R0114:Mug2 UTSW 6 122040648 missense probably damaging 1.00
R0119:Mug2 UTSW 6 122036063 missense probably benign 0.00
R0123:Mug2 UTSW 6 122074714 missense possibly damaging 0.89
R0144:Mug2 UTSW 6 122071011 splice site probably benign
R0225:Mug2 UTSW 6 122074714 missense possibly damaging 0.89
R0514:Mug2 UTSW 6 122081599 missense probably damaging 1.00
R0763:Mug2 UTSW 6 122075294 missense probably benign
R0959:Mug2 UTSW 6 122085495 missense probably benign 0.33
R1104:Mug2 UTSW 6 122059055 missense probably benign
R1239:Mug2 UTSW 6 122081678 splice site probably benign
R1318:Mug2 UTSW 6 122077402 missense probably damaging 1.00
R1460:Mug2 UTSW 6 122040533 splice site probably benign
R1706:Mug2 UTSW 6 122036232 splice site probably benign
R1761:Mug2 UTSW 6 122074705 missense probably benign 0.20
R1901:Mug2 UTSW 6 122071842 missense probably benign 0.02
R1913:Mug2 UTSW 6 122070870 missense probably damaging 1.00
R1943:Mug2 UTSW 6 122079639 missense probably benign
R2054:Mug2 UTSW 6 122077492 missense probably damaging 1.00
R2060:Mug2 UTSW 6 122079612 missense probably benign
R2420:Mug2 UTSW 6 122083460 missense probably damaging 1.00
R2432:Mug2 UTSW 6 122084376 missense possibly damaging 0.93
R2916:Mug2 UTSW 6 122074724 splice site probably null
R2918:Mug2 UTSW 6 122074724 splice site probably null
R3423:Mug2 UTSW 6 122047506 splice site probably benign
R3834:Mug2 UTSW 6 122049787 critical splice donor site probably null
R3902:Mug2 UTSW 6 122075567 missense probably damaging 1.00
R3941:Mug2 UTSW 6 122063563 missense probably benign
R4227:Mug2 UTSW 6 122040732 missense probably benign 0.10
R4284:Mug2 UTSW 6 122063673 missense probably benign 0.00
R4287:Mug2 UTSW 6 122063673 missense probably benign 0.00
R4377:Mug2 UTSW 6 122071007 critical splice donor site probably null
R4419:Mug2 UTSW 6 122079630 missense probably damaging 1.00
R4498:Mug2 UTSW 6 122082752 missense probably damaging 0.99
R4566:Mug2 UTSW 6 122079638 missense probably benign 0.00
R4690:Mug2 UTSW 6 122036296 missense probably benign
R4732:Mug2 UTSW 6 122071872 missense probably damaging 0.99
R4733:Mug2 UTSW 6 122071872 missense probably damaging 0.99
R4741:Mug2 UTSW 6 122079613 missense probably benign
R4888:Mug2 UTSW 6 122081195 missense probably damaging 1.00
R5199:Mug2 UTSW 6 122040660 missense probably benign
R5347:Mug2 UTSW 6 122081592 missense probably damaging 1.00
R5457:Mug2 UTSW 6 122049729 nonsense probably null
R5495:Mug2 UTSW 6 122079650 missense probably damaging 0.96
R5509:Mug2 UTSW 6 122084381 missense possibly damaging 0.84
R6006:Mug2 UTSW 6 122083500 missense probably null 0.98
R6180:Mug2 UTSW 6 122079606 missense probably benign 0.01
R6184:Mug2 UTSW 6 122037046 missense probably benign
R6199:Mug2 UTSW 6 122047439 missense probably benign 0.05
R6262:Mug2 UTSW 6 122075255 missense probably damaging 1.00
R6416:Mug2 UTSW 6 122082754 missense probably damaging 1.00
R6548:Mug2 UTSW 6 122047442 missense probably damaging 1.00
R6703:Mug2 UTSW 6 122078694 missense probably benign 0.25
R7106:Mug2 UTSW 6 122082721 missense probably damaging 1.00
R7131:Mug2 UTSW 6 122075247 missense probably damaging 1.00
R7372:Mug2 UTSW 6 122083466 missense possibly damaging 0.88
R7379:Mug2 UTSW 6 122047487 missense possibly damaging 0.83
R7419:Mug2 UTSW 6 122040570 missense possibly damaging 0.86
R7423:Mug2 UTSW 6 122079726 missense probably benign 0.00
R7582:Mug2 UTSW 6 122079644 missense probably damaging 0.99
R7672:Mug2 UTSW 6 122040719 missense probably benign 0.37
R7713:Mug2 UTSW 6 122078795 missense possibly damaging 0.83
R7759:Mug2 UTSW 6 122081358 missense probably damaging 1.00
R7834:Mug2 UTSW 6 122036282 missense probably benign
R7850:Mug2 UTSW 6 122075211 missense probably damaging 1.00
R8029:Mug2 UTSW 6 122081545 critical splice acceptor site probably null
R8127:Mug2 UTSW 6 122075608 missense probably benign 0.01
R8335:Mug2 UTSW 6 122040584 missense probably benign
R8348:Mug2 UTSW 6 122072233 nonsense probably null
R8557:Mug2 UTSW 6 122063701 missense probably damaging 0.99
R8798:Mug2 UTSW 6 122081610 missense probably damaging 1.00
R8823:Mug2 UTSW 6 122063689 missense possibly damaging 0.89
R9029:Mug2 UTSW 6 122084369 missense probably damaging 1.00
R9153:Mug2 UTSW 6 122040668 missense possibly damaging 0.71
R9185:Mug2 UTSW 6 122077483 missense probably benign 0.06
R9186:Mug2 UTSW 6 122075289 missense probably damaging 0.99
R9418:Mug2 UTSW 6 122040741 missense probably benign 0.00
R9464:Mug2 UTSW 6 122051731 missense probably benign 0.01
R9622:Mug2 UTSW 6 122051792 missense probably benign 0.29
Z1177:Mug2 UTSW 6 122037121 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTAACTTCATAGGGCCTCGTG -3'
(R):5'- AACTATCAGGCAGGTACGTG -3'

Sequencing Primer
(F):5'- GCCTCGTGGGAAATTTGATC -3'
(R):5'- CAGGCAGGTACGTGATAGTTTTTATG -3'
Posted On 2019-10-24