Incidental Mutation 'R7581:Cckbr'
ID586747
Institutional Source Beutler Lab
Gene Symbol Cckbr
Ensembl Gene ENSMUSG00000030898
Gene Namecholecystokinin B receptor
SynonymsCCK2/gastrin, CCK2R, CCKR-2, CCK-B/gastrin receptor
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.067) question?
Stock #R7581 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location105425731-105470898 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 105433786 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 119 (T119A)
Ref Sequence ENSEMBL: ENSMUSP00000033189 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033189] [ENSMUST00000181339]
Predicted Effect probably benign
Transcript: ENSMUST00000033189
AA Change: T119A

PolyPhen 2 Score 0.055 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000033189
Gene: ENSMUSG00000030898
AA Change: T119A

DomainStartEndE-ValueType
low complexity region 9 21 N/A INTRINSIC
low complexity region 27 38 N/A INTRINSIC
Pfam:7tm_1 71 396 4.1e-59 PFAM
low complexity region 409 434 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000181339
AA Change: T119A

PolyPhen 2 Score 0.611 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000138052
Gene: ENSMUSG00000030898
AA Change: T119A

DomainStartEndE-ValueType
low complexity region 9 21 N/A INTRINSIC
low complexity region 27 38 N/A INTRINSIC
Pfam:7tm_1 71 301 3.3e-49 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 98% (47/48)
MGI Phenotype FUNCTION: This gene encodes a multipass transmembrane receptor protein expressed in the central nervous system and gastrointestinal tract. Cholecystokinin and gastrin bind to the encoded protein to stimulate gastric acid secretion and mucosal growth in the gastrointestinal tract, and anxiety, pain sensation and memory in the brain. Mice lacking the encoded protein exhibit an increase in the basal gastric pH and gastrin levels in the bloodstream as well as mild hypocalcemia, secondary hyperparathyroidism and increased bone resorption. [provided by RefSeq, Apr 2015]
PHENOTYPE: Nullizygous mice show gastic mucoca defects, high gastic pH and hypergastrenemia. Homozygotes for a null allele also exhibit higher energy intake and expenditure, less susceptibility to endotoxin shock, altered pain and mechanical sensitivity, and behavioral changes to isolation and addictive drugs. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430403G16Rik G A 5: 109,690,788 probably benign Het
Adamts9 A C 6: 92,937,338 D196E probably benign Het
Adnp A T 2: 168,183,466 D636E probably damaging Het
Afdn T C 17: 13,849,238 V723A probably damaging Het
Arid1a A T 4: 133,680,351 F1897I unknown Het
Atp6v0b T C 4: 117,885,286 M137V probably benign Het
Bicd1 T A 6: 149,519,004 I784N probably damaging Het
Creb5 T C 6: 53,681,237 L184P probably damaging Het
Cyp2a22 T G 7: 26,938,148 K141Q possibly damaging Het
D16Ertd472e T C 16: 78,546,557 T219A possibly damaging Het
Ep400 A T 5: 110,756,025 L236Q unknown Het
Exph5 A G 9: 53,372,557 S313G possibly damaging Het
Gm10024 T C 10: 77,711,563 V36A unknown Het
Gm5493 A G 17: 22,747,274 E44G probably damaging Het
Gtdc1 A T 2: 44,790,005 probably null Het
Invs T C 4: 48,421,909 V847A probably benign Het
Kif18b C A 11: 102,914,722 Q236H probably damaging Het
Kntc1 A G 5: 123,816,755 T2079A probably benign Het
Large2 A G 2: 92,370,193 S89P probably damaging Het
Maml3 A C 3: 51,856,768 D258E probably benign Het
Mdga2 A T 12: 66,506,255 M868K probably damaging Het
Mtss1l A G 8: 110,726,213 E30G possibly damaging Het
Muc16 T C 9: 18,645,614 I3128V unknown Het
Mug2 C T 6: 122,063,711 T740I probably damaging Het
Noc2l T C 4: 156,245,449 V612A probably benign Het
Olfr420 G A 1: 174,158,771 probably null Het
Olfr979 A T 9: 40,000,422 D268E probably damaging Het
Padi6 T C 4: 140,728,929 T585A probably benign Het
Pcdhga1 A T 18: 37,662,177 N78I probably damaging Het
Pdgfd A G 9: 6,293,894 Y156C probably damaging Het
Peg10 GCACATCAGGATCC GCACATCAGGATCCCCATCAGGATCCTCCACATCAGGATCC 6: 4,756,452 probably benign Het
Pi4ka C T 16: 17,301,060 V1307I Het
Pip5k1c A G 10: 81,308,960 N212D probably damaging Het
Plekha1 A G 7: 130,910,865 T264A probably benign Het
Polr2b A G 5: 77,326,704 R463G probably damaging Het
Psd2 T G 18: 35,979,997 D248E probably benign Het
Rag1 G T 2: 101,643,304 Q498K possibly damaging Het
Ryr3 A G 2: 112,753,027 I2853T probably damaging Het
Selenow G T 7: 15,922,382 probably null Het
Sned1 C T 1: 93,256,545 S165F probably benign Het
Spata31d1a A G 13: 59,704,139 probably null Het
Taar4 C A 10: 23,961,154 H221N probably damaging Het
Tgm6 A T 2: 130,141,285 R265W probably damaging Het
Trpm1 A T 7: 64,204,555 Q275L probably benign Het
Ulk3 T C 9: 57,592,042 L173P probably damaging Het
Urah A T 7: 140,835,627 T3S probably benign Het
Vmn1r149 A T 7: 22,437,904 V109D probably damaging Het
Xpc A T 6: 91,498,017 probably benign Het
Zglp1 T A 9: 21,062,708 K227N probably damaging Het
Other mutations in Cckbr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00503:Cckbr APN 7 105434242 missense probably benign 0.01
IGL01630:Cckbr APN 7 105434086 missense probably damaging 1.00
IGL01931:Cckbr APN 7 105426103 missense probably benign
IGL01955:Cckbr APN 7 105434962 missense probably damaging 0.97
IGL02219:Cckbr APN 7 105434048 missense probably damaging 1.00
IGL02820:Cckbr APN 7 105434031 missense probably damaging 1.00
IGL02858:Cckbr APN 7 105434031 missense probably damaging 1.00
IGL02878:Cckbr APN 7 105434031 missense probably damaging 1.00
IGL02946:Cckbr APN 7 105434031 missense probably damaging 1.00
IGL03179:Cckbr APN 7 105434923 missense probably benign 0.02
FR4548:Cckbr UTSW 7 105434681 small deletion probably benign
R0380:Cckbr UTSW 7 105434991 missense probably benign 0.00
R1767:Cckbr UTSW 7 105434551 missense possibly damaging 0.56
R3890:Cckbr UTSW 7 105426169 missense probably benign 0.00
R3892:Cckbr UTSW 7 105426169 missense probably benign 0.00
R5116:Cckbr UTSW 7 105433655 missense probably damaging 1.00
R5589:Cckbr UTSW 7 105434525 missense probably damaging 0.98
R5975:Cckbr UTSW 7 105470619 missense probably benign 0.07
R6797:Cckbr UTSW 7 105434566 missense possibly damaging 0.85
R6940:Cckbr UTSW 7 105434896 missense probably benign 0.00
R7194:Cckbr UTSW 7 105435345 missense possibly damaging 0.72
R7293:Cckbr UTSW 7 105434645 missense probably benign 0.05
R7793:Cckbr UTSW 7 105433591 missense probably benign 0.00
R7891:Cckbr UTSW 7 105435350 missense probably benign 0.00
R7974:Cckbr UTSW 7 105435350 missense probably benign 0.00
RF009:Cckbr UTSW 7 105434686 frame shift probably null
RF039:Cckbr UTSW 7 105434686 frame shift probably null
RF062:Cckbr UTSW 7 105434687 frame shift probably null
Predicted Primers PCR Primer
(F):5'- AATCACCCTTTATGCGGTGATC -3'
(R):5'- GTGGACACACTCACTGATACC -3'

Sequencing Primer
(F):5'- CTTTCTGATGAGTGTTGGCGGAAAC -3'
(R):5'- TCATCTTGGAAACGCGCC -3'
Posted On2019-10-24