Incidental Mutation 'R7581:Plekha1'
ID586748
Institutional Source Beutler Lab
Gene Symbol Plekha1
Ensembl Gene ENSMUSG00000040268
Gene Namepleckstrin homology domain containing, family A (phosphoinositide binding specific) member 1
SynonymsTAPP1, C920009D07Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.281) question?
Stock #R7581 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location130865756-130913312 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 130910865 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 264 (T264A)
Ref Sequence ENSEMBL: ENSMUSP00000035375 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048180] [ENSMUST00000075181] [ENSMUST00000120441] [ENSMUST00000124096] [ENSMUST00000151119]
Predicted Effect probably benign
Transcript: ENSMUST00000048180
AA Change: T264A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000035375
Gene: ENSMUSG00000040268
AA Change: T264A

DomainStartEndE-ValueType
PDB:1V5P|A 1 75 2e-33 PDB
Blast:PH 8 78 1e-36 BLAST
PH 144 243 1.71e-21 SMART
low complexity region 244 261 N/A INTRINSIC
low complexity region 268 287 N/A INTRINSIC
Predicted Effect silent
Transcript: ENSMUST00000075181
SMART Domains Protein: ENSMUSP00000074675
Gene: ENSMUSG00000040268

DomainStartEndE-ValueType
PH 8 114 2.16e-9 SMART
PH 192 291 1.71e-21 SMART
low complexity region 330 341 N/A INTRINSIC
low complexity region 370 381 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000120441
SMART Domains Protein: ENSMUSP00000112777
Gene: ENSMUSG00000040268

DomainStartEndE-ValueType
PH 8 114 2.16e-9 SMART
PH 192 291 1.71e-21 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000124096
SMART Domains Protein: ENSMUSP00000130971
Gene: ENSMUSG00000030849

DomainStartEndE-ValueType
Pfam:Pkinase 1 118 4.8e-19 PFAM
Pfam:Pkinase_Tyr 1 118 1.7e-50 PFAM
low complexity region 146 160 N/A INTRINSIC
Predicted Effect silent
Transcript: ENSMUST00000126355
SMART Domains Protein: ENSMUSP00000114411
Gene: ENSMUSG00000040268

DomainStartEndE-ValueType
Pfam:PH 2 51 6e-8 PFAM
low complexity region 102 113 N/A INTRINSIC
low complexity region 142 153 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000136963
Predicted Effect probably benign
Transcript: ENSMUST00000151119
SMART Domains Protein: ENSMUSP00000123600
Gene: ENSMUSG00000040268

DomainStartEndE-ValueType
PDB:1V5P|A 1 67 3e-35 PDB
Blast:PH 8 67 7e-38 BLAST
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 98% (47/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a pleckstrin homology domain-containing adapter protein. The encoded protein is localized to the plasma membrane where it specifically binds phosphatidylinositol 3,4-bisphosphate. This protein may be involved in the formation of signaling complexes in the plasma membrane. Polymorphisms in this gene are associated with age-related macular degeneration. Alternate splicing results in multiple transcript variants. A pseudogene of this gene is found on chromosome 5.[provided by RefSeq, Sep 2010]
PHENOTYPE: Mcie homozygous for a gene trapped allele exhibit postnatal lethality and increased body weight. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430403G16Rik G A 5: 109,690,788 probably benign Het
Adamts9 A C 6: 92,937,338 D196E probably benign Het
Adnp A T 2: 168,183,466 D636E probably damaging Het
Afdn T C 17: 13,849,238 V723A probably damaging Het
Arid1a A T 4: 133,680,351 F1897I unknown Het
Atp6v0b T C 4: 117,885,286 M137V probably benign Het
Bicd1 T A 6: 149,519,004 I784N probably damaging Het
Cckbr A G 7: 105,433,786 T119A probably benign Het
Creb5 T C 6: 53,681,237 L184P probably damaging Het
Cyp2a22 T G 7: 26,938,148 K141Q possibly damaging Het
D16Ertd472e T C 16: 78,546,557 T219A possibly damaging Het
Ep400 A T 5: 110,756,025 L236Q unknown Het
Exph5 A G 9: 53,372,557 S313G possibly damaging Het
Gm10024 T C 10: 77,711,563 V36A unknown Het
Gm5493 A G 17: 22,747,274 E44G probably damaging Het
Gtdc1 A T 2: 44,790,005 probably null Het
Invs T C 4: 48,421,909 V847A probably benign Het
Kif18b C A 11: 102,914,722 Q236H probably damaging Het
Kntc1 A G 5: 123,816,755 T2079A probably benign Het
Large2 A G 2: 92,370,193 S89P probably damaging Het
Maml3 A C 3: 51,856,768 D258E probably benign Het
Mdga2 A T 12: 66,506,255 M868K probably damaging Het
Mtss1l A G 8: 110,726,213 E30G possibly damaging Het
Muc16 T C 9: 18,645,614 I3128V unknown Het
Mug2 C T 6: 122,063,711 T740I probably damaging Het
Noc2l T C 4: 156,245,449 V612A probably benign Het
Olfr420 G A 1: 174,158,771 probably null Het
Olfr979 A T 9: 40,000,422 D268E probably damaging Het
Padi6 T C 4: 140,728,929 T585A probably benign Het
Pcdhga1 A T 18: 37,662,177 N78I probably damaging Het
Pdgfd A G 9: 6,293,894 Y156C probably damaging Het
Peg10 GCACATCAGGATCC GCACATCAGGATCCCCATCAGGATCCTCCACATCAGGATCC 6: 4,756,452 probably benign Het
Pi4ka C T 16: 17,301,060 V1307I Het
Pip5k1c A G 10: 81,308,960 N212D probably damaging Het
Polr2b A G 5: 77,326,704 R463G probably damaging Het
Psd2 T G 18: 35,979,997 D248E probably benign Het
Rag1 G T 2: 101,643,304 Q498K possibly damaging Het
Ryr3 A G 2: 112,753,027 I2853T probably damaging Het
Selenow G T 7: 15,922,382 probably null Het
Sned1 C T 1: 93,256,545 S165F probably benign Het
Spata31d1a A G 13: 59,704,139 probably null Het
Taar4 C A 10: 23,961,154 H221N probably damaging Het
Tgm6 A T 2: 130,141,285 R265W probably damaging Het
Trpm1 A T 7: 64,204,555 Q275L probably benign Het
Ulk3 T C 9: 57,592,042 L173P probably damaging Het
Urah A T 7: 140,835,627 T3S probably benign Het
Vmn1r149 A T 7: 22,437,904 V109D probably damaging Het
Xpc A T 6: 91,498,017 probably benign Het
Zglp1 T A 9: 21,062,708 K227N probably damaging Het
Other mutations in Plekha1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00495:Plekha1 APN 7 130877839 missense probably damaging 1.00
IGL00973:Plekha1 APN 7 130911013 missense probably damaging 0.96
IGL01010:Plekha1 APN 7 130902254 splice site probably benign
IGL01726:Plekha1 APN 7 130897329 missense probably damaging 1.00
R0137:Plekha1 UTSW 7 130897446 missense probably damaging 0.98
R0681:Plekha1 UTSW 7 130900623 missense possibly damaging 0.50
R1304:Plekha1 UTSW 7 130902219 missense probably benign
R1786:Plekha1 UTSW 7 130892253 missense probably benign 0.02
R2036:Plekha1 UTSW 7 130902192 missense probably damaging 1.00
R2844:Plekha1 UTSW 7 130908365 missense probably damaging 1.00
R2845:Plekha1 UTSW 7 130908365 missense probably damaging 1.00
R2846:Plekha1 UTSW 7 130908365 missense probably damaging 1.00
R5119:Plekha1 UTSW 7 130905364 intron probably benign
R5167:Plekha1 UTSW 7 130885449 critical splice donor site probably null
R5470:Plekha1 UTSW 7 130908376 missense probably damaging 1.00
R5536:Plekha1 UTSW 7 130909601 missense probably damaging 0.96
R5975:Plekha1 UTSW 7 130892253 missense probably benign 0.02
R6087:Plekha1 UTSW 7 130900571 missense probably benign 0.06
R6346:Plekha1 UTSW 7 130877782 missense probably benign 0.17
R8152:Plekha1 UTSW 7 130908372 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATGCATTGCTTTGGGAAGG -3'
(R):5'- TGAGCAAAGCCTGTTCAGTC -3'

Sequencing Primer
(F):5'- AGGAACTTGCACATTTACGCTGC -3'
(R):5'- GAGCAAAGCCTGTTCAGTCACTTTG -3'
Posted On2019-10-24