Incidental Mutation 'R0621:Fam81a'
Institutional Source Beutler Lab
Gene Symbol Fam81a
Ensembl Gene ENSMUSG00000032224
Gene Namefamily with sequence similarity 81, member A
MMRRC Submission 038810-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R0621 (G1)
Quality Score225
Status Not validated
Chromosomal Location70088511-70142560 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 70093647 bp
Amino Acid Change Glutamine to Lysine at position 272 (Q272K)
Ref Sequence ENSEMBL: ENSMUSP00000034749 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034749]
Predicted Effect probably benign
Transcript: ENSMUST00000034749
AA Change: Q272K

PolyPhen 2 Score 0.347 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000034749
Gene: ENSMUSG00000032224
AA Change: Q272K

coiled coil region 75 106 N/A INTRINSIC
coiled coil region 158 187 N/A INTRINSIC
low complexity region 349 358 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 99.0%
  • 10x: 97.8%
  • 20x: 96.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abr T C 11: 76,509,072 D33G probably damaging Het
Adgre1 T A 17: 57,441,359 S520T probably damaging Het
Ankrd40 A G 11: 94,339,607 probably null Het
Aph1b A T 9: 66,779,334 I177K possibly damaging Het
Armc3 A T 2: 19,295,393 N579I probably damaging Het
Atxn7l1 T C 12: 33,326,100 V131A probably benign Het
C130073F10Rik A G 4: 101,890,795 Y61H probably damaging Het
C1s2 A T 6: 124,631,112 L214Q probably damaging Het
Caprin2 A T 6: 148,858,678 S425T possibly damaging Het
Cdc42ep4 G A 11: 113,728,696 R290C probably damaging Het
Cenpf T C 1: 189,672,628 T352A probably benign Het
Col6a4 A T 9: 106,066,791 F1161L probably damaging Het
Dctn2 T C 10: 127,277,940 probably null Het
Ddx24 T C 12: 103,425,558 probably benign Het
Dsg1c C A 18: 20,279,695 A591D possibly damaging Het
Efnb3 T C 11: 69,555,972 D304G probably damaging Het
Erbb3 T C 10: 128,586,225 Y50C probably benign Het
Eya3 T G 4: 132,694,802 D275E probably benign Het
Foxf1 T C 8: 121,085,180 V261A probably damaging Het
Gm9637 G A 14: 19,402,011 noncoding transcript Het
Gnb4 C T 3: 32,591,207 V112I probably benign Het
Gtf2h2 A T 13: 100,488,925 L61Q probably damaging Het
Hey2 T A 10: 30,834,386 I124F probably benign Het
Hoxb3 A T 11: 96,345,963 Y289F probably damaging Het
Kctd3 C T 1: 188,981,341 R399Q probably damaging Het
Kif26b C G 1: 178,915,653 P1105A probably benign Het
Klhl30 C T 1: 91,357,863 T369M probably damaging Het
Lipo2 C T 19: 33,730,939 G225D probably damaging Het
Macf1 T C 4: 123,380,534 K6350E probably damaging Het
Myh13 A C 11: 67,341,232 N446T probably damaging Het
Nos1ap T C 1: 170,318,581 D468G probably damaging Het
Olfr1250 C A 2: 89,657,115 E109* probably null Het
Olfr418 C T 1: 173,270,675 P167S possibly damaging Het
Olfr746 G A 14: 50,653,962 G242R possibly damaging Het
Pde3a T C 6: 141,249,999 L137P probably damaging Het
Ppm1f G A 16: 16,915,308 R233Q probably benign Het
Rtf2 C A 2: 172,466,296 A205E possibly damaging Het
Sh2d5 T C 4: 138,258,318 F359S probably benign Het
Siglec1 G A 2: 131,074,268 T1254M probably benign Het
Slc39a11 G A 11: 113,464,079 P108L probably benign Het
Slc6a5 G A 7: 49,917,365 probably null Het
Snph C T 2: 151,593,722 V360M probably damaging Het
Snx29 A G 16: 11,405,787 probably null Het
Sos1 A G 17: 80,451,979 probably null Het
Spata5 C T 3: 37,432,029 T300I probably benign Het
St8sia6 T A 2: 13,657,282 N246I probably damaging Het
Thy1 T A 9: 44,046,733 F53I probably damaging Het
Tle3 T A 9: 61,410,105 Y421* probably null Het
Ttc21b C T 2: 66,226,011 R677Q probably benign Het
Vmn2r107 A T 17: 20,374,990 I602F probably benign Het
Wdr17 C A 8: 54,643,191 G1016C probably benign Het
Wdr62 T C 7: 30,254,061 E182G possibly damaging Het
Zfp597 A G 16: 3,866,364 I176T probably benign Het
Other mutations in Fam81a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01636:Fam81a APN 9 70099152 nonsense probably null
IGL02010:Fam81a APN 9 70099137 missense probably benign 0.04
IGL02891:Fam81a APN 9 70110276 missense probably damaging 1.00
R0100:Fam81a UTSW 9 70102809 splice site probably benign
R0497:Fam81a UTSW 9 70096119 missense possibly damaging 0.47
R1075:Fam81a UTSW 9 70110274 nonsense probably null
R1524:Fam81a UTSW 9 70125108 missense probably damaging 1.00
R4970:Fam81a UTSW 9 70093590 nonsense probably null
R5138:Fam81a UTSW 9 70099175 missense probably benign 0.01
R5209:Fam81a UTSW 9 70125160 missense probably benign 0.06
R6139:Fam81a UTSW 9 70102818 critical splice donor site probably null
R6378:Fam81a UTSW 9 70110346 missense probably damaging 1.00
R7145:Fam81a UTSW 9 70110278 missense probably damaging 1.00
R8030:Fam81a UTSW 9 70102909 missense probably benign 0.11
R8350:Fam81a UTSW 9 70125018 missense probably damaging 1.00
R8450:Fam81a UTSW 9 70125018 missense probably damaging 1.00
Predicted Primers PCR Primer

Sequencing Primer
(F):5'- gagtatagttccctggtagcac -3'
Posted On2013-07-11