Incidental Mutation 'R7581:Mtss1l'
ID586750
Institutional Source Beutler Lab
Gene Symbol Mtss1l
Ensembl Gene ENSMUSG00000033763
Gene Namemetastasis suppressor 1-like
SynonymsABBA
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7581 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location110721476-110741400 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 110726213 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 30 (E30G)
Ref Sequence ENSEMBL: ENSMUSP00000050211 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052457] [ENSMUST00000144041]
Predicted Effect possibly damaging
Transcript: ENSMUST00000052457
AA Change: E30G

PolyPhen 2 Score 0.924 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000050211
Gene: ENSMUSG00000033763
AA Change: E30G

DomainStartEndE-ValueType
Pfam:IMD 15 236 8.1e-108 PFAM
low complexity region 252 274 N/A INTRINSIC
low complexity region 284 295 N/A INTRINSIC
low complexity region 312 330 N/A INTRINSIC
low complexity region 368 386 N/A INTRINSIC
low complexity region 429 442 N/A INTRINSIC
low complexity region 546 562 N/A INTRINSIC
low complexity region 668 690 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000141302
SMART Domains Protein: ENSMUSP00000116518
Gene: ENSMUSG00000033763

DomainStartEndE-ValueType
Pfam:IMD 1 122 1e-56 PFAM
low complexity region 138 179 N/A INTRINSIC
low complexity region 202 213 N/A INTRINSIC
low complexity region 230 248 N/A INTRINSIC
low complexity region 286 304 N/A INTRINSIC
low complexity region 347 360 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000144041
SMART Domains Protein: ENSMUSP00000115220
Gene: ENSMUSG00000033763

DomainStartEndE-ValueType
Pfam:IMD 1 174 3.6e-72 PFAM
low complexity region 190 212 N/A INTRINSIC
low complexity region 222 233 N/A INTRINSIC
low complexity region 250 268 N/A INTRINSIC
low complexity region 306 324 N/A INTRINSIC
low complexity region 367 380 N/A INTRINSIC
low complexity region 484 500 N/A INTRINSIC
low complexity region 606 628 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000149273
SMART Domains Protein: ENSMUSP00000119495
Gene: ENSMUSG00000033763

DomainStartEndE-ValueType
Pfam:IMD 1 126 2.5e-59 PFAM
low complexity region 142 183 N/A INTRINSIC
low complexity region 206 217 N/A INTRINSIC
low complexity region 239 249 N/A INTRINSIC
Meta Mutation Damage Score 0.2956 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 98% (47/48)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430403G16Rik G A 5: 109,690,788 probably benign Het
Adamts9 A C 6: 92,937,338 D196E probably benign Het
Adnp A T 2: 168,183,466 D636E probably damaging Het
Afdn T C 17: 13,849,238 V723A probably damaging Het
Arid1a A T 4: 133,680,351 F1897I unknown Het
Atp6v0b T C 4: 117,885,286 M137V probably benign Het
Bicd1 T A 6: 149,519,004 I784N probably damaging Het
Cckbr A G 7: 105,433,786 T119A probably benign Het
Creb5 T C 6: 53,681,237 L184P probably damaging Het
Cyp2a22 T G 7: 26,938,148 K141Q possibly damaging Het
D16Ertd472e T C 16: 78,546,557 T219A possibly damaging Het
Ep400 A T 5: 110,756,025 L236Q unknown Het
Exph5 A G 9: 53,372,557 S313G possibly damaging Het
Gm10024 T C 10: 77,711,563 V36A unknown Het
Gm5493 A G 17: 22,747,274 E44G probably damaging Het
Gtdc1 A T 2: 44,790,005 probably null Het
Invs T C 4: 48,421,909 V847A probably benign Het
Kif18b C A 11: 102,914,722 Q236H probably damaging Het
Kntc1 A G 5: 123,816,755 T2079A probably benign Het
Large2 A G 2: 92,370,193 S89P probably damaging Het
Maml3 A C 3: 51,856,768 D258E probably benign Het
Mdga2 A T 12: 66,506,255 M868K probably damaging Het
Muc16 T C 9: 18,645,614 I3128V unknown Het
Mug2 C T 6: 122,063,711 T740I probably damaging Het
Noc2l T C 4: 156,245,449 V612A probably benign Het
Olfr420 G A 1: 174,158,771 probably null Het
Olfr979 A T 9: 40,000,422 D268E probably damaging Het
Padi6 T C 4: 140,728,929 T585A probably benign Het
Pcdhga1 A T 18: 37,662,177 N78I probably damaging Het
Pdgfd A G 9: 6,293,894 Y156C probably damaging Het
Peg10 GCACATCAGGATCC GCACATCAGGATCCCCATCAGGATCCTCCACATCAGGATCC 6: 4,756,452 probably benign Het
Pi4ka C T 16: 17,301,060 V1307I Het
Pip5k1c A G 10: 81,308,960 N212D probably damaging Het
Plekha1 A G 7: 130,910,865 T264A probably benign Het
Polr2b A G 5: 77,326,704 R463G probably damaging Het
Psd2 T G 18: 35,979,997 D248E probably benign Het
Rag1 G T 2: 101,643,304 Q498K possibly damaging Het
Ryr3 A G 2: 112,753,027 I2853T probably damaging Het
Selenow G T 7: 15,922,382 probably null Het
Sned1 C T 1: 93,256,545 S165F probably benign Het
Spata31d1a A G 13: 59,704,139 probably null Het
Taar4 C A 10: 23,961,154 H221N probably damaging Het
Tgm6 A T 2: 130,141,285 R265W probably damaging Het
Trpm1 A T 7: 64,204,555 Q275L probably benign Het
Ulk3 T C 9: 57,592,042 L173P probably damaging Het
Urah A T 7: 140,835,627 T3S probably benign Het
Vmn1r149 A T 7: 22,437,904 V109D probably damaging Het
Xpc A T 6: 91,498,017 probably benign Het
Zglp1 T A 9: 21,062,708 K227N probably damaging Het
Other mutations in Mtss1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02124:Mtss1l APN 8 110737624 missense probably damaging 1.00
R0620:Mtss1l UTSW 8 110737948 missense probably damaging 0.98
R0685:Mtss1l UTSW 8 110727397 critical splice donor site probably null
R2082:Mtss1l UTSW 8 110726257 critical splice donor site probably null
R2149:Mtss1l UTSW 8 110726383 missense possibly damaging 0.58
R2266:Mtss1l UTSW 8 110728730 missense possibly damaging 0.80
R2267:Mtss1l UTSW 8 110728730 missense possibly damaging 0.80
R2269:Mtss1l UTSW 8 110728730 missense possibly damaging 0.80
R2378:Mtss1l UTSW 8 110738349 missense probably damaging 1.00
R3756:Mtss1l UTSW 8 110730060 missense probably damaging 1.00
R4005:Mtss1l UTSW 8 110739041 frame shift probably null
R4552:Mtss1l UTSW 8 110738505 missense probably damaging 1.00
R4553:Mtss1l UTSW 8 110738505 missense probably damaging 1.00
R4849:Mtss1l UTSW 8 110726243 missense possibly damaging 0.92
R5212:Mtss1l UTSW 8 110729218 missense probably damaging 1.00
R6294:Mtss1l UTSW 8 110727328 missense possibly damaging 0.89
R6336:Mtss1l UTSW 8 110732164 missense probably damaging 1.00
R7090:Mtss1l UTSW 8 110730024 missense probably damaging 1.00
R7580:Mtss1l UTSW 8 110737636 missense possibly damaging 0.95
R7810:Mtss1l UTSW 8 110726201 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ATGCCATCCTTTGTCCTGGG -3'
(R):5'- TCAGCTACTTTCTGGAAGGC -3'

Sequencing Primer
(F):5'- GGCCCTCTCTTGCCCAATAGG -3'
(R):5'- AGCTACTTTCTGGAAGGCATCGAG -3'
Posted On2019-10-24