Incidental Mutation 'R7581:Zglp1'
ID 586753
Institutional Source Beutler Lab
Gene Symbol Zglp1
Ensembl Gene ENSMUSG00000079681
Gene Name zinc finger, GATA-like protein 1
Synonyms Glp1
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.496) question?
Stock # R7581 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 21062393-21067093 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 21062708 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Asparagine at position 227 (K227N)
Ref Sequence ENSEMBL: ENSMUSP00000111157 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000010348] [ENSMUST00000115494] [ENSMUST00000213826] [ENSMUST00000217359]
AlphaFold Q1WG82
Predicted Effect probably benign
Transcript: ENSMUST00000010348
SMART Domains Protein: ENSMUSP00000010348
Gene: ENSMUSG00000079677

DomainStartEndE-ValueType
Pfam:Fer2 64 147 5.3e-12 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000115494
AA Change: K227N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000111157
Gene: ENSMUSG00000079681
AA Change: K227N

DomainStartEndE-ValueType
Pfam:GATA 197 231 7.8e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213826
Predicted Effect probably benign
Transcript: ENSMUST00000217282
Predicted Effect probably benign
Transcript: ENSMUST00000217359
Meta Mutation Damage Score 0.3060 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 98% (47/48)
MGI Phenotype PHENOTYPE: Mutations result in female and male infertility due to failure of germ cell development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430403G16Rik G A 5: 109,690,788 probably benign Het
Adamts9 A C 6: 92,937,338 D196E probably benign Het
Adnp A T 2: 168,183,466 D636E probably damaging Het
Afdn T C 17: 13,849,238 V723A probably damaging Het
Arid1a A T 4: 133,680,351 F1897I unknown Het
Atp6v0b T C 4: 117,885,286 M137V probably benign Het
Bicd1 T A 6: 149,519,004 I784N probably damaging Het
Cckbr A G 7: 105,433,786 T119A probably benign Het
Creb5 T C 6: 53,681,237 L184P probably damaging Het
Cyp2a22 T G 7: 26,938,148 K141Q possibly damaging Het
D16Ertd472e T C 16: 78,546,557 T219A possibly damaging Het
Ep400 A T 5: 110,756,025 L236Q unknown Het
Exph5 A G 9: 53,372,557 S313G possibly damaging Het
Gm10024 T C 10: 77,711,563 V36A unknown Het
Gm5493 A G 17: 22,747,274 E44G probably damaging Het
Gtdc1 A T 2: 44,790,005 probably null Het
Invs T C 4: 48,421,909 V847A probably benign Het
Kif18b C A 11: 102,914,722 Q236H probably damaging Het
Kntc1 A G 5: 123,816,755 T2079A probably benign Het
Large2 A G 2: 92,370,193 S89P probably damaging Het
Maml3 A C 3: 51,856,768 D258E probably benign Het
Mdga2 A T 12: 66,506,255 M868K probably damaging Het
Mtss1l A G 8: 110,726,213 E30G possibly damaging Het
Muc16 T C 9: 18,645,614 I3128V unknown Het
Mug2 C T 6: 122,063,711 T740I probably damaging Het
Noc2l T C 4: 156,245,449 V612A probably benign Het
Olfr420 G A 1: 174,158,771 probably null Het
Olfr979 A T 9: 40,000,422 D268E probably damaging Het
Padi6 T C 4: 140,728,929 T585A probably benign Het
Pcdhga1 A T 18: 37,662,177 N78I probably damaging Het
Pdgfd A G 9: 6,293,894 Y156C probably damaging Het
Peg10 GCACATCAGGATCC GCACATCAGGATCCCCATCAGGATCCTCCACATCAGGATCC 6: 4,756,452 probably benign Het
Pi4ka C T 16: 17,301,060 V1307I Het
Pip5k1c A G 10: 81,308,960 N212D probably damaging Het
Plekha1 A G 7: 130,910,865 T264A probably benign Het
Polr2b A G 5: 77,326,704 R463G probably damaging Het
Psd2 T G 18: 35,979,997 D248E probably benign Het
Rag1 G T 2: 101,643,304 Q498K possibly damaging Het
Ryr3 A G 2: 112,753,027 I2853T probably damaging Het
Selenow G T 7: 15,922,382 probably null Het
Sned1 C T 1: 93,256,545 S165F probably benign Het
Spata31d1a A G 13: 59,704,139 probably null Het
Taar4 C A 10: 23,961,154 H221N probably damaging Het
Tgm6 A T 2: 130,141,285 R265W probably damaging Het
Trpm1 A T 7: 64,204,555 Q275L probably benign Het
Ulk3 T C 9: 57,592,042 L173P probably damaging Het
Urah A T 7: 140,835,627 T3S probably benign Het
Vmn1r149 A T 7: 22,437,904 V109D probably damaging Het
Xpc A T 6: 91,498,017 probably benign Het
Other mutations in Zglp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01718:Zglp1 APN 9 21063379 missense probably benign 0.31
IGL02039:Zglp1 APN 9 21067039 missense possibly damaging 0.95
IGL02682:Zglp1 APN 9 21066238 missense probably benign 0.00
IGL03040:Zglp1 APN 9 21063326 missense probably damaging 1.00
PIT4515001:Zglp1 UTSW 9 21066189 missense probably benign 0.01
R0366:Zglp1 UTSW 9 21063379 missense probably benign 0.31
R4174:Zglp1 UTSW 9 21066070 missense possibly damaging 0.94
R4888:Zglp1 UTSW 9 21062661 missense probably benign 0.00
R5121:Zglp1 UTSW 9 21062661 missense probably benign 0.00
R7103:Zglp1 UTSW 9 21066072 missense probably benign 0.30
R7481:Zglp1 UTSW 9 21062607 missense probably benign
R9109:Zglp1 UTSW 9 21066186 missense probably benign 0.08
R9298:Zglp1 UTSW 9 21066186 missense probably benign 0.08
Z1088:Zglp1 UTSW 9 21067000 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- CAGCCTCCATTGTCTCCAATAG -3'
(R):5'- CCACTATGGAGAGACGCTGAAG -3'

Sequencing Primer
(F):5'- TCCAATAGAGAAACTGAGACAAAGC -3'
(R):5'- TGTGGCATCAGGTCCTCAAC -3'
Posted On 2019-10-24