Incidental Mutation 'R7581:Ulk3'
ID 586756
Institutional Source Beutler Lab
Gene Symbol Ulk3
Ensembl Gene ENSMUSG00000032308
Gene Name unc-51-like kinase 3
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R7581 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 57589452-57596233 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 57592042 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 173 (L173P)
Ref Sequence ENSEMBL: ENSMUSP00000059947 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045791] [ENSMUST00000053230] [ENSMUST00000215748]
AlphaFold Q3U3Q1
Predicted Effect probably benign
Transcript: ENSMUST00000045791
SMART Domains Protein: ENSMUSP00000038350
Gene: ENSMUSG00000040188

DomainStartEndE-ValueType
low complexity region 69 83 N/A INTRINSIC
low complexity region 94 106 N/A INTRINSIC
Pfam:SCAMP 117 293 2.6e-68 PFAM
low complexity region 309 328 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000053230
AA Change: L173P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000059947
Gene: ENSMUSG00000032308
AA Change: L173P

DomainStartEndE-ValueType
S_TKc 14 270 4.74e-98 SMART
MIT 277 354 1.1e-10 SMART
MIT 372 450 2.96e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000215748
Meta Mutation Damage Score 0.9524 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 98% (47/48)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430403G16Rik G A 5: 109,690,788 probably benign Het
Adamts9 A C 6: 92,937,338 D196E probably benign Het
Adnp A T 2: 168,183,466 D636E probably damaging Het
Afdn T C 17: 13,849,238 V723A probably damaging Het
Arid1a A T 4: 133,680,351 F1897I unknown Het
Atp6v0b T C 4: 117,885,286 M137V probably benign Het
Bicd1 T A 6: 149,519,004 I784N probably damaging Het
Cckbr A G 7: 105,433,786 T119A probably benign Het
Creb5 T C 6: 53,681,237 L184P probably damaging Het
Cyp2a22 T G 7: 26,938,148 K141Q possibly damaging Het
D16Ertd472e T C 16: 78,546,557 T219A possibly damaging Het
Ep400 A T 5: 110,756,025 L236Q unknown Het
Exph5 A G 9: 53,372,557 S313G possibly damaging Het
Gm10024 T C 10: 77,711,563 V36A unknown Het
Gm5493 A G 17: 22,747,274 E44G probably damaging Het
Gtdc1 A T 2: 44,790,005 probably null Het
Invs T C 4: 48,421,909 V847A probably benign Het
Kif18b C A 11: 102,914,722 Q236H probably damaging Het
Kntc1 A G 5: 123,816,755 T2079A probably benign Het
Large2 A G 2: 92,370,193 S89P probably damaging Het
Maml3 A C 3: 51,856,768 D258E probably benign Het
Mdga2 A T 12: 66,506,255 M868K probably damaging Het
Mtss1l A G 8: 110,726,213 E30G possibly damaging Het
Muc16 T C 9: 18,645,614 I3128V unknown Het
Mug2 C T 6: 122,063,711 T740I probably damaging Het
Noc2l T C 4: 156,245,449 V612A probably benign Het
Olfr420 G A 1: 174,158,771 probably null Het
Olfr979 A T 9: 40,000,422 D268E probably damaging Het
Padi6 T C 4: 140,728,929 T585A probably benign Het
Pcdhga1 A T 18: 37,662,177 N78I probably damaging Het
Pdgfd A G 9: 6,293,894 Y156C probably damaging Het
Peg10 GCACATCAGGATCC GCACATCAGGATCCCCATCAGGATCCTCCACATCAGGATCC 6: 4,756,452 probably benign Het
Pi4ka C T 16: 17,301,060 V1307I Het
Pip5k1c A G 10: 81,308,960 N212D probably damaging Het
Plekha1 A G 7: 130,910,865 T264A probably benign Het
Polr2b A G 5: 77,326,704 R463G probably damaging Het
Psd2 T G 18: 35,979,997 D248E probably benign Het
Rag1 G T 2: 101,643,304 Q498K possibly damaging Het
Ryr3 A G 2: 112,753,027 I2853T probably damaging Het
Selenow G T 7: 15,922,382 probably null Het
Sned1 C T 1: 93,256,545 S165F probably benign Het
Spata31d1a A G 13: 59,704,139 probably null Het
Taar4 C A 10: 23,961,154 H221N probably damaging Het
Tgm6 A T 2: 130,141,285 R265W probably damaging Het
Trpm1 A T 7: 64,204,555 Q275L probably benign Het
Urah A T 7: 140,835,627 T3S probably benign Het
Vmn1r149 A T 7: 22,437,904 V109D probably damaging Het
Xpc A T 6: 91,498,017 probably benign Het
Zglp1 T A 9: 21,062,708 K227N probably damaging Het
Other mutations in Ulk3
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0023:Ulk3 UTSW 9 57590356 nonsense probably null
R0164:Ulk3 UTSW 9 57590686 missense probably damaging 1.00
R0164:Ulk3 UTSW 9 57590686 missense probably damaging 1.00
R0334:Ulk3 UTSW 9 57594227 unclassified probably benign
R0391:Ulk3 UTSW 9 57594832 missense probably benign
R1635:Ulk3 UTSW 9 57593160 critical splice acceptor site probably null
R2696:Ulk3 UTSW 9 57590441 missense possibly damaging 0.63
R3689:Ulk3 UTSW 9 57593794 missense probably benign 0.44
R4151:Ulk3 UTSW 9 57592367 missense possibly damaging 0.64
R4502:Ulk3 UTSW 9 57593229 missense probably damaging 1.00
R4586:Ulk3 UTSW 9 57594310 missense possibly damaging 0.81
R4746:Ulk3 UTSW 9 57592918 missense probably benign
R5034:Ulk3 UTSW 9 57593764 missense possibly damaging 0.88
R5288:Ulk3 UTSW 9 57590740 missense possibly damaging 0.81
R5385:Ulk3 UTSW 9 57590740 missense possibly damaging 0.81
R5386:Ulk3 UTSW 9 57590740 missense possibly damaging 0.81
R7480:Ulk3 UTSW 9 57591240 nonsense probably null
R8848:Ulk3 UTSW 9 57589607 missense probably benign
R8976:Ulk3 UTSW 9 57594937 unclassified probably benign
R9002:Ulk3 UTSW 9 57593259 missense probably damaging 1.00
Z1177:Ulk3 UTSW 9 57589545 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- TGTGCCATGCAGAGGGTTTC -3'
(R):5'- TCTCATCTGAACCCAGGAGAGG -3'

Sequencing Primer
(F):5'- CCCCAGGGATATAGGAGTATTGCAC -3'
(R):5'- AACCCAGGAGAGGCCCAG -3'
Posted On 2019-10-24