Incidental Mutation 'R7581:Taar4'
ID586757
Institutional Source Beutler Lab
Gene Symbol Taar4
Ensembl Gene ENSMUSG00000069707
Gene Nametrace amine-associated receptor 4
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.168) question?
Stock #R7581 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location23960494-23961537 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 23961154 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Asparagine at position 221 (H221N)
Ref Sequence ENSEMBL: ENSMUSP00000090330 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092660]
Predicted Effect probably damaging
Transcript: ENSMUST00000092660
AA Change: H221N

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000090330
Gene: ENSMUSG00000069707
AA Change: H221N

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 44 328 9.2e-11 PFAM
Pfam:7tm_1 50 313 4.6e-63 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 98% (47/48)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired olfactory response and aversion to PEA and puma urine. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430403G16Rik G A 5: 109,690,788 probably benign Het
Adamts9 A C 6: 92,937,338 D196E probably benign Het
Adnp A T 2: 168,183,466 D636E probably damaging Het
Afdn T C 17: 13,849,238 V723A probably damaging Het
Arid1a A T 4: 133,680,351 F1897I unknown Het
Atp6v0b T C 4: 117,885,286 M137V probably benign Het
Bicd1 T A 6: 149,519,004 I784N probably damaging Het
Cckbr A G 7: 105,433,786 T119A probably benign Het
Creb5 T C 6: 53,681,237 L184P probably damaging Het
Cyp2a22 T G 7: 26,938,148 K141Q possibly damaging Het
D16Ertd472e T C 16: 78,546,557 T219A possibly damaging Het
Ep400 A T 5: 110,756,025 L236Q unknown Het
Exph5 A G 9: 53,372,557 S313G possibly damaging Het
Gm10024 T C 10: 77,711,563 V36A unknown Het
Gm5493 A G 17: 22,747,274 E44G probably damaging Het
Gtdc1 A T 2: 44,790,005 probably null Het
Invs T C 4: 48,421,909 V847A probably benign Het
Kif18b C A 11: 102,914,722 Q236H probably damaging Het
Kntc1 A G 5: 123,816,755 T2079A probably benign Het
Large2 A G 2: 92,370,193 S89P probably damaging Het
Maml3 A C 3: 51,856,768 D258E probably benign Het
Mdga2 A T 12: 66,506,255 M868K probably damaging Het
Mtss1l A G 8: 110,726,213 E30G possibly damaging Het
Muc16 T C 9: 18,645,614 I3128V unknown Het
Mug2 C T 6: 122,063,711 T740I probably damaging Het
Noc2l T C 4: 156,245,449 V612A probably benign Het
Olfr420 G A 1: 174,158,771 probably null Het
Olfr979 A T 9: 40,000,422 D268E probably damaging Het
Padi6 T C 4: 140,728,929 T585A probably benign Het
Pcdhga1 A T 18: 37,662,177 N78I probably damaging Het
Pdgfd A G 9: 6,293,894 Y156C probably damaging Het
Peg10 GCACATCAGGATCC GCACATCAGGATCCCCATCAGGATCCTCCACATCAGGATCC 6: 4,756,452 probably benign Het
Pi4ka C T 16: 17,301,060 V1307I Het
Pip5k1c A G 10: 81,308,960 N212D probably damaging Het
Plekha1 A G 7: 130,910,865 T264A probably benign Het
Polr2b A G 5: 77,326,704 R463G probably damaging Het
Psd2 T G 18: 35,979,997 D248E probably benign Het
Rag1 G T 2: 101,643,304 Q498K possibly damaging Het
Ryr3 A G 2: 112,753,027 I2853T probably damaging Het
Selenow G T 7: 15,922,382 probably null Het
Sned1 C T 1: 93,256,545 S165F probably benign Het
Spata31d1a A G 13: 59,704,139 probably null Het
Tgm6 A T 2: 130,141,285 R265W probably damaging Het
Trpm1 A T 7: 64,204,555 Q275L probably benign Het
Ulk3 T C 9: 57,592,042 L173P probably damaging Het
Urah A T 7: 140,835,627 T3S probably benign Het
Vmn1r149 A T 7: 22,437,904 V109D probably damaging Het
Xpc A T 6: 91,498,017 probably benign Het
Zglp1 T A 9: 21,062,708 K227N probably damaging Het
Other mutations in Taar4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02576:Taar4 APN 10 23961011 missense probably damaging 1.00
IGL03202:Taar4 APN 10 23960794 missense probably damaging 1.00
I2288:Taar4 UTSW 10 23960920 missense probably benign 0.03
R0103:Taar4 UTSW 10 23961406 missense probably damaging 1.00
R0103:Taar4 UTSW 10 23961406 missense probably damaging 1.00
R0514:Taar4 UTSW 10 23960882 missense probably damaging 1.00
R1222:Taar4 UTSW 10 23961332 missense probably benign 0.05
R1248:Taar4 UTSW 10 23961038 missense possibly damaging 0.95
R1514:Taar4 UTSW 10 23960612 missense possibly damaging 0.71
R1921:Taar4 UTSW 10 23961341 missense probably damaging 1.00
R2074:Taar4 UTSW 10 23961173 missense probably benign 0.18
R2354:Taar4 UTSW 10 23961014 missense probably damaging 1.00
R2392:Taar4 UTSW 10 23961274 missense possibly damaging 0.94
R2698:Taar4 UTSW 10 23961430 missense probably damaging 1.00
R3902:Taar4 UTSW 10 23961015 missense probably damaging 1.00
R4688:Taar4 UTSW 10 23960833 missense probably damaging 1.00
R5495:Taar4 UTSW 10 23961283 missense possibly damaging 0.95
R5595:Taar4 UTSW 10 23960741 missense probably damaging 1.00
R5773:Taar4 UTSW 10 23961158 missense probably damaging 1.00
R7403:Taar4 UTSW 10 23961059 missense probably damaging 1.00
R7736:Taar4 UTSW 10 23960999 missense probably damaging 1.00
R7859:Taar4 UTSW 10 23961134 missense probably benign 0.35
R8676:Taar4 UTSW 10 23960903 missense possibly damaging 0.56
Predicted Primers PCR Primer
(F):5'- GGTAGGGGTCTTTCTACTCATC -3'
(R):5'- AGGGTCTGTGATTGTCAAGAC -3'

Sequencing Primer
(F):5'- AGGGGTCTTTCTACTCATCAGTTG -3'
(R):5'- AAAGTCTTGGTGGCCTTG -3'
Posted On2019-10-24