Incidental Mutation 'R7581:Pip5k1c'
ID586759
Institutional Source Beutler Lab
Gene Symbol Pip5k1c
Ensembl Gene ENSMUSG00000034902
Gene Namephosphatidylinositol-4-phosphate 5-kinase, type 1 gamma
SynonymsPIP5KIgamma
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7581 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location81292963-81319973 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 81308960 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 212 (N212D)
Ref Sequence ENSEMBL: ENSMUSP00000038225 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045469] [ENSMUST00000105327] [ENSMUST00000160291] [ENSMUST00000161719] [ENSMUST00000161854] [ENSMUST00000161869] [ENSMUST00000163075]
Predicted Effect probably damaging
Transcript: ENSMUST00000045469
AA Change: N212D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000038225
Gene: ENSMUSG00000034902
AA Change: N212D

DomainStartEndE-ValueType
low complexity region 8 32 N/A INTRINSIC
low complexity region 69 78 N/A INTRINSIC
PIPKc 103 444 2.72e-164 SMART
low complexity region 518 534 N/A INTRINSIC
low complexity region 575 591 N/A INTRINSIC
low complexity region 601 628 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000105327
AA Change: N212D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000100964
Gene: ENSMUSG00000034902
AA Change: N212D

DomainStartEndE-ValueType
low complexity region 8 32 N/A INTRINSIC
low complexity region 69 78 N/A INTRINSIC
PIPKc 103 444 2.72e-164 SMART
low complexity region 518 534 N/A INTRINSIC
low complexity region 575 591 N/A INTRINSIC
low complexity region 601 628 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160291
SMART Domains Protein: ENSMUSP00000125645
Gene: ENSMUSG00000034902

DomainStartEndE-ValueType
low complexity region 8 32 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161586
SMART Domains Protein: ENSMUSP00000124612
Gene: ENSMUSG00000034902

DomainStartEndE-ValueType
low complexity region 28 44 N/A INTRINSIC
low complexity region 54 81 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161719
SMART Domains Protein: ENSMUSP00000125461
Gene: ENSMUSG00000034902

DomainStartEndE-ValueType
Pfam:PIP5K 1 133 1.4e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000161854
SMART Domains Protein: ENSMUSP00000124004
Gene: ENSMUSG00000034902

DomainStartEndE-ValueType
low complexity region 8 32 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161869
SMART Domains Protein: ENSMUSP00000124235
Gene: ENSMUSG00000034902

DomainStartEndE-ValueType
low complexity region 7 36 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000163075
AA Change: N212D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124155
Gene: ENSMUSG00000034902
AA Change: N212D

DomainStartEndE-ValueType
low complexity region 8 32 N/A INTRINSIC
low complexity region 69 78 N/A INTRINSIC
PIPKc 103 444 2.72e-164 SMART
low complexity region 518 534 N/A INTRINSIC
low complexity region 575 591 N/A INTRINSIC
low complexity region 601 628 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 98% (47/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This locus encodes a type I phosphatidylinositol 4-phosphate 5-kinase. The encoded protein catalyzes phosphorylation of phosphatidylinositol 4-phosphate, producing phosphatidylinositol 4,5-bisphosphate. This enzyme is found at synapses and has been found to play roles in endocytosis and cell migration. Mutations at this locus have been associated with lethal congenital contractural syndrome. Alternatively spliced transcript variants encoding different isoforms have been described.[provided by RefSeq, Sep 2010]
PHENOTYPE: Mutations in this locus cause variable phenotypes. One allele shows embryonic lethality, abnormal cardiovascular and neuronal development and impaired integrity of the megakaryocyte membrane cytoskeleton. Another allele exhibits neonatal lethality, synaptic transmission and plasticity defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430403G16Rik G A 5: 109,690,788 probably benign Het
Adamts9 A C 6: 92,937,338 D196E probably benign Het
Adnp A T 2: 168,183,466 D636E probably damaging Het
Afdn T C 17: 13,849,238 V723A probably damaging Het
Arid1a A T 4: 133,680,351 F1897I unknown Het
Atp6v0b T C 4: 117,885,286 M137V probably benign Het
Bicd1 T A 6: 149,519,004 I784N probably damaging Het
Cckbr A G 7: 105,433,786 T119A probably benign Het
Creb5 T C 6: 53,681,237 L184P probably damaging Het
Cyp2a22 T G 7: 26,938,148 K141Q possibly damaging Het
D16Ertd472e T C 16: 78,546,557 T219A possibly damaging Het
Ep400 A T 5: 110,756,025 L236Q unknown Het
Exph5 A G 9: 53,372,557 S313G possibly damaging Het
Gm10024 T C 10: 77,711,563 V36A unknown Het
Gm5493 A G 17: 22,747,274 E44G probably damaging Het
Gtdc1 A T 2: 44,790,005 probably null Het
Invs T C 4: 48,421,909 V847A probably benign Het
Kif18b C A 11: 102,914,722 Q236H probably damaging Het
Kntc1 A G 5: 123,816,755 T2079A probably benign Het
Large2 A G 2: 92,370,193 S89P probably damaging Het
Maml3 A C 3: 51,856,768 D258E probably benign Het
Mdga2 A T 12: 66,506,255 M868K probably damaging Het
Mtss1l A G 8: 110,726,213 E30G possibly damaging Het
Muc16 T C 9: 18,645,614 I3128V unknown Het
Mug2 C T 6: 122,063,711 T740I probably damaging Het
Noc2l T C 4: 156,245,449 V612A probably benign Het
Olfr420 G A 1: 174,158,771 probably null Het
Olfr979 A T 9: 40,000,422 D268E probably damaging Het
Padi6 T C 4: 140,728,929 T585A probably benign Het
Pcdhga1 A T 18: 37,662,177 N78I probably damaging Het
Pdgfd A G 9: 6,293,894 Y156C probably damaging Het
Peg10 GCACATCAGGATCC GCACATCAGGATCCCCATCAGGATCCTCCACATCAGGATCC 6: 4,756,452 probably benign Het
Pi4ka C T 16: 17,301,060 V1307I Het
Plekha1 A G 7: 130,910,865 T264A probably benign Het
Polr2b A G 5: 77,326,704 R463G probably damaging Het
Psd2 T G 18: 35,979,997 D248E probably benign Het
Rag1 G T 2: 101,643,304 Q498K possibly damaging Het
Ryr3 A G 2: 112,753,027 I2853T probably damaging Het
Selenow G T 7: 15,922,382 probably null Het
Sned1 C T 1: 93,256,545 S165F probably benign Het
Spata31d1a A G 13: 59,704,139 probably null Het
Taar4 C A 10: 23,961,154 H221N probably damaging Het
Tgm6 A T 2: 130,141,285 R265W probably damaging Het
Trpm1 A T 7: 64,204,555 Q275L probably benign Het
Ulk3 T C 9: 57,592,042 L173P probably damaging Het
Urah A T 7: 140,835,627 T3S probably benign Het
Vmn1r149 A T 7: 22,437,904 V109D probably damaging Het
Xpc A T 6: 91,498,017 probably benign Het
Zglp1 T A 9: 21,062,708 K227N probably damaging Het
Other mutations in Pip5k1c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00428:Pip5k1c APN 10 81305711 missense probably benign 0.45
IGL02274:Pip5k1c APN 10 81306384 missense probably damaging 1.00
IGL02500:Pip5k1c APN 10 81317321 splice site probably null
IGL02565:Pip5k1c APN 10 81317321 splice site probably null
IGL02577:Pip5k1c APN 10 81317321 splice site probably null
IGL02579:Pip5k1c APN 10 81317321 splice site probably null
IGL02581:Pip5k1c APN 10 81317321 splice site probably null
IGL02604:Pip5k1c APN 10 81317321 splice site probably null
IGL02610:Pip5k1c APN 10 81317321 splice site probably null
IGL02613:Pip5k1c APN 10 81317321 splice site probably null
IGL02616:Pip5k1c APN 10 81317321 splice site probably null
IGL02617:Pip5k1c APN 10 81317321 splice site probably null
IGL02639:Pip5k1c APN 10 81317321 splice site probably null
IGL02641:Pip5k1c APN 10 81317321 splice site probably null
IGL02642:Pip5k1c APN 10 81317321 splice site probably null
IGL02724:Pip5k1c APN 10 81313462 missense probably benign 0.01
IGL02751:Pip5k1c APN 10 81317321 splice site probably null
PIT4366001:Pip5k1c UTSW 10 81309008 missense probably damaging 0.98
R0257:Pip5k1c UTSW 10 81315096 missense possibly damaging 0.86
R1643:Pip5k1c UTSW 10 81314994 missense probably damaging 1.00
R1663:Pip5k1c UTSW 10 81312515 missense probably damaging 1.00
R1872:Pip5k1c UTSW 10 81306319 missense probably damaging 0.99
R2293:Pip5k1c UTSW 10 81314084 missense possibly damaging 0.82
R2295:Pip5k1c UTSW 10 81305186 missense probably benign 0.40
R2310:Pip5k1c UTSW 10 81306308 missense probably damaging 0.96
R2406:Pip5k1c UTSW 10 81309024 missense probably damaging 1.00
R4504:Pip5k1c UTSW 10 81315111 missense probably damaging 0.98
R4772:Pip5k1c UTSW 10 81315940 missense probably benign
R5022:Pip5k1c UTSW 10 81310889 splice site probably null
R5023:Pip5k1c UTSW 10 81310889 splice site probably null
R5033:Pip5k1c UTSW 10 81305250 missense probably damaging 0.99
R5057:Pip5k1c UTSW 10 81310889 splice site probably null
R5482:Pip5k1c UTSW 10 81293063 missense probably damaging 0.98
R6305:Pip5k1c UTSW 10 81315934 missense probably benign 0.02
R6511:Pip5k1c UTSW 10 81310817 missense probably damaging 1.00
R6544:Pip5k1c UTSW 10 81308996 missense probably damaging 1.00
R7512:Pip5k1c UTSW 10 81315119 critical splice donor site probably null
Z1177:Pip5k1c UTSW 10 81315032 missense possibly damaging 0.56
Predicted Primers PCR Primer
(F):5'- CCAGAATCCAACAGAGGGTC -3'
(R):5'- CCATCAGCATTTTCTATATGGGG -3'

Sequencing Primer
(F):5'- AGGGTCTGGGGGTGGAGTAC -3'
(R):5'- ATGTCCTGCATGAAGTCCAG -3'
Posted On2019-10-24