Mutagenetix > Incidental Mutation

Incidental Mutation 'R7581:Pip5k1c'

586759

Institutional Source

Beutler Lab

Gene Symbol

Pip5k1c

Ensembl Gene

ENSMUSG00000034902

Gene Name

phosphatidylinositol-4-phosphate 5-kinase, type 1 gamma

Synonyms

PIP5KIgamma

MMRRC Submission

045634-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R7581 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

81292963-81319973 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 81308960 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Aspartic acid at position 212 (N212D)

Ref Sequence

ENSEMBL: ENSMUSP00000038225 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000045469] [ENSMUST00000105327] [ENSMUST00000160291] [ENSMUST00000161719] [ENSMUST00000161854] [ENSMUST00000161869] [ENSMUST00000163075]

AlphaFold

O70161

Predicted Effect

probably damaging
Transcript: ENSMUST00000045469
AA Change: N212D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000038225
Gene: ENSMUSG00000034902
AA Change: N212D

Domain	Start	End	E-Value	Type
low complexity region	8	32	N/A	INTRINSIC
low complexity region	69	78	N/A	INTRINSIC
PIPKc	103	444	2.72e-164	SMART
low complexity region	518	534	N/A	INTRINSIC
low complexity region	575	591	N/A	INTRINSIC
low complexity region	601	628	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000105327
AA Change: N212D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000100964
Gene: ENSMUSG00000034902
AA Change: N212D

Domain	Start	End	E-Value	Type
low complexity region	8	32	N/A	INTRINSIC
low complexity region	69	78	N/A	INTRINSIC
PIPKc	103	444	2.72e-164	SMART
low complexity region	518	534	N/A	INTRINSIC
low complexity region	575	591	N/A	INTRINSIC
low complexity region	601	628	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000160291

SMART Domains

Protein: ENSMUSP00000125645
Gene: ENSMUSG00000034902

Domain	Start	End	E-Value	Type
low complexity region	8	32	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000161586

SMART Domains

Protein: ENSMUSP00000124612
Gene: ENSMUSG00000034902

Domain	Start	End	E-Value	Type
low complexity region	28	44	N/A	INTRINSIC
low complexity region	54	81	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000161719

SMART Domains

Protein: ENSMUSP00000125461
Gene: ENSMUSG00000034902

Domain	Start	End	E-Value	Type
Pfam:PIP5K	1	133	1.4e-28	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000161854

SMART Domains

Protein: ENSMUSP00000124004
Gene: ENSMUSG00000034902

Domain	Start	End	E-Value	Type
low complexity region	8	32	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000161869

SMART Domains

Protein: ENSMUSP00000124235
Gene: ENSMUSG00000034902

Domain	Start	End	E-Value	Type
low complexity region	7	36	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000163075
AA Change: N212D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000124155
Gene: ENSMUSG00000034902
AA Change: N212D

Domain	Start	End	E-Value	Type
low complexity region	8	32	N/A	INTRINSIC
low complexity region	69	78	N/A	INTRINSIC
PIPKc	103	444	2.72e-164	SMART
low complexity region	518	534	N/A	INTRINSIC
low complexity region	575	591	N/A	INTRINSIC
low complexity region	601	628	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.2%

Validation Efficiency

98% (47/48)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This locus encodes a type I phosphatidylinositol 4-phosphate 5-kinase. The encoded protein catalyzes phosphorylation of phosphatidylinositol 4-phosphate, producing phosphatidylinositol 4,5-bisphosphate. This enzyme is found at synapses and has been found to play roles in endocytosis and cell migration. Mutations at this locus have been associated with lethal congenital contractural syndrome. Alternatively spliced transcript variants encoding different isoforms have been described.[provided by RefSeq, Sep 2010]
PHENOTYPE: Mutations in this locus cause variable phenotypes. One allele shows embryonic lethality, abnormal cardiovascular and neuronal development and impaired integrity of the megakaryocyte membrane cytoskeleton. Another allele exhibits neonatal lethality, synaptic transmission and plasticity defects. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5430403G16Rik	G	A	5: 109,690,788		probably benign	Het
Adamts9	A	C	6: 92,937,338	D196E	probably benign	Het
Adnp	A	T	2: 168,183,466	D636E	probably damaging	Het
Afdn	T	C	17: 13,849,238	V723A	probably damaging	Het
Arid1a	A	T	4: 133,680,351	F1897I	unknown	Het
Atp6v0b	T	C	4: 117,885,286	M137V	probably benign	Het
Bicd1	T	A	6: 149,519,004	I784N	probably damaging	Het
Cckbr	A	G	7: 105,433,786	T119A	probably benign	Het
Creb5	T	C	6: 53,681,237	L184P	probably damaging	Het
Cyp2a22	T	G	7: 26,938,148	K141Q	possibly damaging	Het
D16Ertd472e	T	C	16: 78,546,557	T219A	possibly damaging	Het
Ep400	A	T	5: 110,756,025	L236Q	unknown	Het
Exph5	A	G	9: 53,372,557	S313G	possibly damaging	Het
Gm10024	T	C	10: 77,711,563	V36A	unknown	Het
Gm5493	A	G	17: 22,747,274	E44G	probably damaging	Het
Gtdc1	A	T	2: 44,790,005		probably null	Het
Invs	T	C	4: 48,421,909	V847A	probably benign	Het
Kif18b	C	A	11: 102,914,722	Q236H	probably damaging	Het
Kntc1	A	G	5: 123,816,755	T2079A	probably benign	Het
Large2	A	G	2: 92,370,193	S89P	probably damaging	Het
Maml3	A	C	3: 51,856,768	D258E	probably benign	Het
Mdga2	A	T	12: 66,506,255	M868K	probably damaging	Het
Mtss1l	A	G	8: 110,726,213	E30G	possibly damaging	Het
Muc16	T	C	9: 18,645,614	I3128V	unknown	Het
Mug2	C	T	6: 122,063,711	T740I	probably damaging	Het
Noc2l	T	C	4: 156,245,449	V612A	probably benign	Het
Olfr420	G	A	1: 174,158,771		probably null	Het
Olfr979	A	T	9: 40,000,422	D268E	probably damaging	Het
Padi6	T	C	4: 140,728,929	T585A	probably benign	Het
Pcdhga1	A	T	18: 37,662,177	N78I	probably damaging	Het
Pdgfd	A	G	9: 6,293,894	Y156C	probably damaging	Het
Peg10	GCACATCAGGATCC	GCACATCAGGATCCCCATCAGGATCCTCCACATCAGGATCC	6: 4,756,452		probably benign	Het
Pi4ka	C	T	16: 17,301,060	V1307I		Het
Plekha1	A	G	7: 130,910,865	T264A	probably benign	Het
Polr2b	A	G	5: 77,326,704	R463G	probably damaging	Het
Psd2	T	G	18: 35,979,997	D248E	probably benign	Het
Rag1	G	T	2: 101,643,304	Q498K	possibly damaging	Het
Ryr3	A	G	2: 112,753,027	I2853T	probably damaging	Het
Selenow	G	T	7: 15,922,382		probably null	Het
Sned1	C	T	1: 93,256,545	S165F	probably benign	Het
Spata31d1a	A	G	13: 59,704,139		probably null	Het
Taar4	C	A	10: 23,961,154	H221N	probably damaging	Het
Tgm6	A	T	2: 130,141,285	R265W	probably damaging	Het
Trpm1	A	T	7: 64,204,555	Q275L	probably benign	Het
Ulk3	T	C	9: 57,592,042	L173P	probably damaging	Het
Urah	A	T	7: 140,835,627	T3S	probably benign	Het
Vmn1r149	A	T	7: 22,437,904	V109D	probably damaging	Het
Xpc	A	T	6: 91,498,017		probably benign	Het
Zglp1	T	A	9: 21,062,708	K227N	probably damaging	Het

Other mutations in Pip5k1c

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00428:Pip5k1c	APN	10	81305711	missense	probably benign	0.45
IGL02274:Pip5k1c	APN	10	81306384	missense	probably damaging	1.00
IGL02500:Pip5k1c	APN	10	81317321	splice site	probably null
IGL02565:Pip5k1c	APN	10	81317321	splice site	probably null
IGL02577:Pip5k1c	APN	10	81317321	splice site	probably null
IGL02579:Pip5k1c	APN	10	81317321	splice site	probably null
IGL02581:Pip5k1c	APN	10	81317321	splice site	probably null
IGL02604:Pip5k1c	APN	10	81317321	splice site	probably null
IGL02610:Pip5k1c	APN	10	81317321	splice site	probably null
IGL02613:Pip5k1c	APN	10	81317321	splice site	probably null
IGL02616:Pip5k1c	APN	10	81317321	splice site	probably null
IGL02617:Pip5k1c	APN	10	81317321	splice site	probably null
IGL02639:Pip5k1c	APN	10	81317321	splice site	probably null
IGL02641:Pip5k1c	APN	10	81317321	splice site	probably null
IGL02642:Pip5k1c	APN	10	81317321	splice site	probably null
IGL02724:Pip5k1c	APN	10	81313462	missense	probably benign	0.01
IGL02751:Pip5k1c	APN	10	81317321	splice site	probably null
PIT4366001:Pip5k1c	UTSW	10	81309008	missense	probably damaging	0.98
R0257:Pip5k1c	UTSW	10	81315096	missense	possibly damaging	0.86
R1643:Pip5k1c	UTSW	10	81314994	missense	probably damaging	1.00
R1663:Pip5k1c	UTSW	10	81312515	missense	probably damaging	1.00
R1872:Pip5k1c	UTSW	10	81306319	missense	probably damaging	0.99
R2293:Pip5k1c	UTSW	10	81314084	missense	possibly damaging	0.82
R2295:Pip5k1c	UTSW	10	81305186	missense	probably benign	0.40
R2310:Pip5k1c	UTSW	10	81306308	missense	probably damaging	0.96
R2406:Pip5k1c	UTSW	10	81309024	missense	probably damaging	1.00
R4504:Pip5k1c	UTSW	10	81315111	missense	probably damaging	0.98
R4772:Pip5k1c	UTSW	10	81315940	missense	probably benign
R5022:Pip5k1c	UTSW	10	81310889	splice site	probably null
R5023:Pip5k1c	UTSW	10	81310889	splice site	probably null
R5033:Pip5k1c	UTSW	10	81305250	missense	probably damaging	0.99
R5057:Pip5k1c	UTSW	10	81310889	splice site	probably null
R5482:Pip5k1c	UTSW	10	81293063	missense	probably damaging	0.98
R6305:Pip5k1c	UTSW	10	81315934	missense	probably benign	0.02
R6511:Pip5k1c	UTSW	10	81310817	missense	probably damaging	1.00
R6544:Pip5k1c	UTSW	10	81308996	missense	probably damaging	1.00
R7512:Pip5k1c	UTSW	10	81315119	critical splice donor site	probably null
R8218:Pip5k1c	UTSW	10	81306416	missense	probably damaging	1.00
R8686:Pip5k1c	UTSW	10	81311993	missense	probably damaging	0.99
R8927:Pip5k1c	UTSW	10	81293072	missense	possibly damaging	0.95
R8928:Pip5k1c	UTSW	10	81293072	missense	possibly damaging	0.95
R9048:Pip5k1c	UTSW	10	81316876	intron	probably benign
R9049:Pip5k1c	UTSW	10	81316876	intron	probably benign
R9100:Pip5k1c	UTSW	10	81309222	missense	probably benign	0.01
R9443:Pip5k1c	UTSW	10	81317350	missense	probably damaging	0.99
R9448:Pip5k1c	UTSW	10	81305811	missense	probably damaging	1.00
R9466:Pip5k1c	UTSW	10	81316876	intron	probably benign
R9775:Pip5k1c	UTSW	10	81312019	missense	probably damaging	0.98
R9780:Pip5k1c	UTSW	10	81305196	missense	probably benign	0.01
Z1177:Pip5k1c	UTSW	10	81315032	missense	possibly damaging	0.56

Predicted Primers

PCR Primer
(F):5'- CCAGAATCCAACAGAGGGTC -3'
(R):5'- CCATCAGCATTTTCTATATGGGG -3'

Sequencing Primer
(F):5'- AGGGTCTGGGGGTGGAGTAC -3'
(R):5'- ATGTCCTGCATGAAGTCCAG -3'

Posted On

2019-10-24