Incidental Mutation 'R7581:Mdga2'
ID 586761
Institutional Source Beutler Lab
Gene Symbol Mdga2
Ensembl Gene ENSMUSG00000034912
Gene Name MAM domain containing glycosylphosphatidylinositol anchor 2
Synonyms 6720489L24Rik, Mdga2, Adp, 9330209L04Rik, Mamdc1
MMRRC Submission 045634-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7581 (G1)
Quality Score 225.009
Status Validated
Chromosome 12
Chromosomal Location 66512834-67269323 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 66553029 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 868 (M868K)
Ref Sequence ENSEMBL: ENSMUSP00000046761 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037181] [ENSMUST00000222167] [ENSMUST00000222623] [ENSMUST00000222987] [ENSMUST00000223141]
AlphaFold P60755
Predicted Effect probably damaging
Transcript: ENSMUST00000037181
AA Change: M868K

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000046761
Gene: ENSMUSG00000034912
AA Change: M868K

DomainStartEndE-ValueType
IGc2 122 186 1.38e-15 SMART
IG 213 307 1.79e0 SMART
IGc2 324 386 1.56e-14 SMART
IGc2 419 493 4.43e-5 SMART
low complexity region 495 507 N/A INTRINSIC
IGc2 525 591 1.97e-11 SMART
IG_like 621 687 2.5e0 SMART
Blast:FN3 707 795 4e-40 BLAST
MAM 812 990 3.4e-49 SMART
transmembrane domain 999 1021 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000101379
SMART Domains Protein: ENSMUSP00000098930
Gene: ENSMUSG00000034912

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
SCOP:d1cs6a1 40 72 2e-5 SMART
Blast:IG 47 72 9e-11 BLAST
Predicted Effect
SMART Domains Protein: ENSMUSP00000137608
Gene: ENSMUSG00000034912
AA Change: M851K

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IGc2 53 117 1.38e-15 SMART
IG 144 238 1.79e0 SMART
IGc2 255 317 1.56e-14 SMART
IGc2 350 424 4.43e-5 SMART
low complexity region 426 438 N/A INTRINSIC
IGc2 456 522 1.97e-11 SMART
IG_like 552 618 2.5e0 SMART
Blast:FN3 638 726 3e-40 BLAST
MAM 736 914 1.38e-49 SMART
transmembrane domain 923 945 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000222167
AA Change: M799K

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000222623
AA Change: M140K

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000222987
AA Change: M140K

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
Predicted Effect probably damaging
Transcript: ENSMUST00000223141
AA Change: M792K

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
Meta Mutation Damage Score 0.9255 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 98% (47/48)
MGI Phenotype PHENOTYPE: Mice that paternally inherit an allele disrupted by transgene insertion exhibit varying degrees of abnormalities in the skull, paw, and tail. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts9 A C 6: 92,914,319 (GRCm39) D196E probably benign Het
Adnp A T 2: 168,025,386 (GRCm39) D636E probably damaging Het
Afdn T C 17: 14,069,500 (GRCm39) V723A probably damaging Het
Arid1a A T 4: 133,407,662 (GRCm39) F1897I unknown Het
Atp6v0b T C 4: 117,742,483 (GRCm39) M137V probably benign Het
Bicd1 T A 6: 149,420,502 (GRCm39) I784N probably damaging Het
Cckbr A G 7: 105,082,993 (GRCm39) T119A probably benign Het
Creb5 T C 6: 53,658,222 (GRCm39) L184P probably damaging Het
Cyp2a22 T G 7: 26,637,573 (GRCm39) K141Q possibly damaging Het
D16Ertd472e T C 16: 78,343,445 (GRCm39) T219A possibly damaging Het
Ep400 A T 5: 110,903,891 (GRCm39) L236Q unknown Het
Exph5 A G 9: 53,283,857 (GRCm39) S313G possibly damaging Het
Gm10024 T C 10: 77,547,397 (GRCm39) V36A unknown Het
Gm5493 A G 17: 22,966,247 (GRCm39) E44G probably damaging Het
Gtdc1 A T 2: 44,680,017 (GRCm39) probably null Het
Invs T C 4: 48,421,909 (GRCm39) V847A probably benign Het
Kif18b C A 11: 102,805,548 (GRCm39) Q236H probably damaging Het
Kntc1 A G 5: 123,954,818 (GRCm39) T2079A probably benign Het
Large2 A G 2: 92,200,538 (GRCm39) S89P probably damaging Het
Maml3 A C 3: 51,764,189 (GRCm39) D258E probably benign Het
Mtss2 A G 8: 111,452,845 (GRCm39) E30G possibly damaging Het
Muc16 T C 9: 18,556,910 (GRCm39) I3128V unknown Het
Mug2 C T 6: 122,040,670 (GRCm39) T740I probably damaging Het
Noc2l T C 4: 156,329,906 (GRCm39) V612A probably benign Het
Or10g9 A T 9: 39,911,718 (GRCm39) D268E probably damaging Het
Or6k2 G A 1: 173,986,337 (GRCm39) probably null Het
Padi6 T C 4: 140,456,240 (GRCm39) T585A probably benign Het
Pcdhga1 A T 18: 37,795,230 (GRCm39) N78I probably damaging Het
Pdgfd A G 9: 6,293,894 (GRCm39) Y156C probably damaging Het
Peg10 GCACATCAGGATCC GCACATCAGGATCCCCATCAGGATCCTCCACATCAGGATCC 6: 4,756,452 (GRCm39) probably benign Het
Pi4ka C T 16: 17,118,924 (GRCm39) V1307I Het
Pip5k1c A G 10: 81,144,794 (GRCm39) N212D probably damaging Het
Plekha1 A G 7: 130,512,595 (GRCm39) T264A probably benign Het
Polr2b A G 5: 77,474,551 (GRCm39) R463G probably damaging Het
Psd2 T G 18: 36,113,050 (GRCm39) D248E probably benign Het
Rag1 G T 2: 101,473,649 (GRCm39) Q498K possibly damaging Het
Ryr3 A G 2: 112,583,372 (GRCm39) I2853T probably damaging Het
Selenow G T 7: 15,656,307 (GRCm39) probably null Het
Sned1 C T 1: 93,184,267 (GRCm39) S165F probably benign Het
Spata31d1a A G 13: 59,851,953 (GRCm39) probably null Het
Taar4 C A 10: 23,837,052 (GRCm39) H221N probably damaging Het
Tgm6 A T 2: 129,983,205 (GRCm39) R265W probably damaging Het
Trpm1 A T 7: 63,854,303 (GRCm39) Q275L probably benign Het
Ulk3 T C 9: 57,499,325 (GRCm39) L173P probably damaging Het
Urah A T 7: 140,415,540 (GRCm39) T3S probably benign Het
Vmn1r149 A T 7: 22,137,329 (GRCm39) V109D probably damaging Het
Xpc A T 6: 91,474,999 (GRCm39) probably benign Het
Zfp1007 G A 5: 109,838,654 (GRCm39) probably benign Het
Zglp1 T A 9: 20,974,004 (GRCm39) K227N probably damaging Het
Other mutations in Mdga2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01343:Mdga2 APN 12 66,769,883 (GRCm39) missense probably damaging 0.97
IGL01632:Mdga2 APN 12 66,676,672 (GRCm39) splice site probably benign
IGL01843:Mdga2 APN 12 66,769,905 (GRCm39) critical splice acceptor site probably null
IGL02230:Mdga2 APN 12 66,702,197 (GRCm39) nonsense probably null
IGL02348:Mdga2 APN 12 66,597,349 (GRCm39) missense probably damaging 1.00
IGL02473:Mdga2 APN 12 66,597,385 (GRCm39) missense possibly damaging 0.73
IGL02795:Mdga2 APN 12 66,736,206 (GRCm39) missense probably benign 0.00
IGL02901:Mdga2 APN 12 66,844,583 (GRCm39) splice site probably benign
IGL03373:Mdga2 APN 12 66,763,496 (GRCm39) missense probably damaging 0.99
PIT4362001:Mdga2 UTSW 12 66,844,542 (GRCm39) missense possibly damaging 0.83
PIT4377001:Mdga2 UTSW 12 66,763,469 (GRCm39) missense probably damaging 0.99
R0106:Mdga2 UTSW 12 66,763,480 (GRCm39) missense probably damaging 1.00
R0106:Mdga2 UTSW 12 66,763,480 (GRCm39) missense probably damaging 1.00
R0110:Mdga2 UTSW 12 66,517,700 (GRCm39) missense possibly damaging 0.66
R0218:Mdga2 UTSW 12 66,701,894 (GRCm39) missense probably damaging 1.00
R0450:Mdga2 UTSW 12 66,517,700 (GRCm39) missense possibly damaging 0.66
R0801:Mdga2 UTSW 12 66,533,507 (GRCm39) missense probably damaging 1.00
R0847:Mdga2 UTSW 12 66,769,854 (GRCm39) missense probably damaging 1.00
R1056:Mdga2 UTSW 12 66,769,894 (GRCm39) missense probably damaging 0.97
R1086:Mdga2 UTSW 12 66,552,876 (GRCm39) splice site probably benign
R1335:Mdga2 UTSW 12 66,763,516 (GRCm39) splice site probably null
R1382:Mdga2 UTSW 12 66,517,690 (GRCm39) missense possibly damaging 0.68
R1490:Mdga2 UTSW 12 66,844,530 (GRCm39) missense probably benign 0.01
R1521:Mdga2 UTSW 12 66,615,700 (GRCm39) missense probably benign 0.00
R1556:Mdga2 UTSW 12 66,597,367 (GRCm39) missense possibly damaging 0.92
R1676:Mdga2 UTSW 12 66,615,547 (GRCm39) nonsense probably null
R1676:Mdga2 UTSW 12 66,615,546 (GRCm39) missense probably damaging 1.00
R1698:Mdga2 UTSW 12 66,736,109 (GRCm39) missense probably damaging 0.97
R1954:Mdga2 UTSW 12 66,533,482 (GRCm39) splice site probably benign
R2069:Mdga2 UTSW 12 66,615,691 (GRCm39) nonsense probably null
R2077:Mdga2 UTSW 12 66,702,136 (GRCm39) missense probably damaging 1.00
R2118:Mdga2 UTSW 12 66,915,526 (GRCm39) missense probably damaging 1.00
R2146:Mdga2 UTSW 12 66,915,515 (GRCm39) missense probably damaging 1.00
R2158:Mdga2 UTSW 12 66,736,155 (GRCm39) missense possibly damaging 0.64
R2189:Mdga2 UTSW 12 66,519,970 (GRCm39) splice site probably null
R2293:Mdga2 UTSW 12 66,615,759 (GRCm39) nonsense probably null
R2886:Mdga2 UTSW 12 66,553,044 (GRCm39) splice site probably benign
R2960:Mdga2 UTSW 12 66,676,752 (GRCm39) nonsense probably null
R3937:Mdga2 UTSW 12 67,267,980 (GRCm39) unclassified probably benign
R4437:Mdga2 UTSW 12 66,519,972 (GRCm39) splice site probably null
R4514:Mdga2 UTSW 12 66,763,496 (GRCm39) missense probably damaging 0.99
R4693:Mdga2 UTSW 12 66,844,407 (GRCm39) missense possibly damaging 0.81
R4719:Mdga2 UTSW 12 66,517,775 (GRCm39) unclassified probably benign
R4744:Mdga2 UTSW 12 66,844,501 (GRCm39) missense probably benign 0.01
R4756:Mdga2 UTSW 12 66,844,427 (GRCm39) missense probably damaging 1.00
R4781:Mdga2 UTSW 12 66,844,396 (GRCm39) splice site probably null
R5022:Mdga2 UTSW 12 66,517,534 (GRCm39) missense possibly damaging 0.83
R5108:Mdga2 UTSW 12 66,533,515 (GRCm39) missense probably benign 0.43
R5479:Mdga2 UTSW 12 66,701,950 (GRCm39) missense probably damaging 1.00
R5710:Mdga2 UTSW 12 66,553,556 (GRCm39) missense probably damaging 1.00
R5816:Mdga2 UTSW 12 66,701,956 (GRCm39) missense probably damaging 1.00
R5822:Mdga2 UTSW 12 66,702,109 (GRCm39) missense probably damaging 1.00
R5996:Mdga2 UTSW 12 66,844,537 (GRCm39) missense probably benign 0.00
R6038:Mdga2 UTSW 12 66,676,827 (GRCm39) missense probably damaging 1.00
R6038:Mdga2 UTSW 12 66,676,827 (GRCm39) missense probably damaging 1.00
R6297:Mdga2 UTSW 12 66,553,027 (GRCm39) missense probably damaging 1.00
R6484:Mdga2 UTSW 12 66,676,843 (GRCm39) missense possibly damaging 0.90
R6830:Mdga2 UTSW 12 66,769,775 (GRCm39) missense probably damaging 1.00
R6912:Mdga2 UTSW 12 66,552,889 (GRCm39) missense probably benign 0.01
R6971:Mdga2 UTSW 12 66,597,335 (GRCm39) missense probably damaging 1.00
R7053:Mdga2 UTSW 12 66,736,158 (GRCm39) missense probably benign 0.41
R7069:Mdga2 UTSW 12 66,533,526 (GRCm39) missense probably benign 0.31
R7381:Mdga2 UTSW 12 66,615,670 (GRCm39) missense probably benign 0.44
R7474:Mdga2 UTSW 12 66,533,535 (GRCm39) nonsense probably null
R7559:Mdga2 UTSW 12 66,520,003 (GRCm39) missense probably damaging 1.00
R7596:Mdga2 UTSW 12 66,552,897 (GRCm39) missense probably damaging 0.99
R7745:Mdga2 UTSW 12 66,736,125 (GRCm39) missense possibly damaging 0.63
R7745:Mdga2 UTSW 12 66,736,124 (GRCm39) missense probably damaging 0.99
R7852:Mdga2 UTSW 12 66,517,724 (GRCm39) missense possibly damaging 0.66
R8144:Mdga2 UTSW 12 66,702,037 (GRCm39) missense probably damaging 1.00
R8319:Mdga2 UTSW 12 67,267,803 (GRCm39) missense unknown
R8715:Mdga2 UTSW 12 66,915,526 (GRCm39) missense probably damaging 1.00
R8977:Mdga2 UTSW 12 66,844,409 (GRCm39) missense possibly damaging 0.88
R9138:Mdga2 UTSW 12 66,615,663 (GRCm39) missense possibly damaging 0.89
R9177:Mdga2 UTSW 12 66,517,481 (GRCm39) missense possibly damaging 0.66
R9223:Mdga2 UTSW 12 66,615,634 (GRCm39) missense possibly damaging 0.81
R9248:Mdga2 UTSW 12 66,736,226 (GRCm39) missense possibly damaging 0.87
R9264:Mdga2 UTSW 12 66,560,057 (GRCm39) missense probably damaging 1.00
R9381:Mdga2 UTSW 12 66,597,304 (GRCm39) missense possibly damaging 0.64
R9456:Mdga2 UTSW 12 66,615,532 (GRCm39) missense probably benign 0.44
R9633:Mdga2 UTSW 12 66,736,206 (GRCm39) missense probably benign 0.00
Z1176:Mdga2 UTSW 12 66,736,217 (GRCm39) missense probably damaging 1.00
Z1186:Mdga2 UTSW 12 66,615,727 (GRCm39) missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- CAATTGAACGTCTGTTACCTTACC -3'
(R):5'- CACAGTTGAGAGATCAGGCTG -3'

Sequencing Primer
(F):5'- CTATATGTTGCCCGTACATGTGATAG -3'
(R):5'- TGAGAGATCAGGCTGTTTTTATTTAC -3'
Posted On 2019-10-24