Incidental Mutation 'R7581:Spata31d1a'
ID586762
Institutional Source Beutler Lab
Gene Symbol Spata31d1a
Ensembl Gene ENSMUSG00000050876
Gene Namespermatogenesis associated 31 subfamily D, member 1A
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.054) question?
Stock #R7581 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location59699806-59710330 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 59704139 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000128533 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066510] [ENSMUST00000224469] [ENSMUST00000224982]
Predicted Effect probably null
Transcript: ENSMUST00000066510
SMART Domains Protein: ENSMUSP00000128533
Gene: ENSMUSG00000050876

DomainStartEndE-ValueType
transmembrane domain 31 53 N/A INTRINSIC
Pfam:DUF4599 66 150 3.7e-25 PFAM
low complexity region 196 217 N/A INTRINSIC
low complexity region 240 266 N/A INTRINSIC
Pfam:FAM75 400 772 2.9e-108 PFAM
low complexity region 1144 1154 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000224469
Predicted Effect probably null
Transcript: ENSMUST00000224982
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 98% (47/48)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430403G16Rik G A 5: 109,690,788 probably benign Het
Adamts9 A C 6: 92,937,338 D196E probably benign Het
Adnp A T 2: 168,183,466 D636E probably damaging Het
Afdn T C 17: 13,849,238 V723A probably damaging Het
Arid1a A T 4: 133,680,351 F1897I unknown Het
Atp6v0b T C 4: 117,885,286 M137V probably benign Het
Bicd1 T A 6: 149,519,004 I784N probably damaging Het
Cckbr A G 7: 105,433,786 T119A probably benign Het
Creb5 T C 6: 53,681,237 L184P probably damaging Het
Cyp2a22 T G 7: 26,938,148 K141Q possibly damaging Het
D16Ertd472e T C 16: 78,546,557 T219A possibly damaging Het
Ep400 A T 5: 110,756,025 L236Q unknown Het
Exph5 A G 9: 53,372,557 S313G possibly damaging Het
Gm10024 T C 10: 77,711,563 V36A unknown Het
Gm5493 A G 17: 22,747,274 E44G probably damaging Het
Gtdc1 A T 2: 44,790,005 probably null Het
Invs T C 4: 48,421,909 V847A probably benign Het
Kif18b C A 11: 102,914,722 Q236H probably damaging Het
Kntc1 A G 5: 123,816,755 T2079A probably benign Het
Large2 A G 2: 92,370,193 S89P probably damaging Het
Maml3 A C 3: 51,856,768 D258E probably benign Het
Mdga2 A T 12: 66,506,255 M868K probably damaging Het
Mtss1l A G 8: 110,726,213 E30G possibly damaging Het
Muc16 T C 9: 18,645,614 I3128V unknown Het
Mug2 C T 6: 122,063,711 T740I probably damaging Het
Noc2l T C 4: 156,245,449 V612A probably benign Het
Olfr420 G A 1: 174,158,771 probably null Het
Olfr979 A T 9: 40,000,422 D268E probably damaging Het
Padi6 T C 4: 140,728,929 T585A probably benign Het
Pcdhga1 A T 18: 37,662,177 N78I probably damaging Het
Pdgfd A G 9: 6,293,894 Y156C probably damaging Het
Peg10 GCACATCAGGATCC GCACATCAGGATCCCCATCAGGATCCTCCACATCAGGATCC 6: 4,756,452 probably benign Het
Pi4ka C T 16: 17,301,060 V1307I Het
Pip5k1c A G 10: 81,308,960 N212D probably damaging Het
Plekha1 A G 7: 130,910,865 T264A probably benign Het
Polr2b A G 5: 77,326,704 R463G probably damaging Het
Psd2 T G 18: 35,979,997 D248E probably benign Het
Rag1 G T 2: 101,643,304 Q498K possibly damaging Het
Ryr3 A G 2: 112,753,027 I2853T probably damaging Het
Selenow G T 7: 15,922,382 probably null Het
Sned1 C T 1: 93,256,545 S165F probably benign Het
Taar4 C A 10: 23,961,154 H221N probably damaging Het
Tgm6 A T 2: 130,141,285 R265W probably damaging Het
Trpm1 A T 7: 64,204,555 Q275L probably benign Het
Ulk3 T C 9: 57,592,042 L173P probably damaging Het
Urah A T 7: 140,835,627 T3S probably benign Het
Vmn1r149 A T 7: 22,437,904 V109D probably damaging Het
Xpc A T 6: 91,498,017 probably benign Het
Zglp1 T A 9: 21,062,708 K227N probably damaging Het
Other mutations in Spata31d1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00915:Spata31d1a APN 13 59702185 missense probably benign 0.27
IGL01397:Spata31d1a APN 13 59701738 missense probably damaging 0.99
IGL01448:Spata31d1a APN 13 59701559 missense probably benign 0.06
IGL02715:Spata31d1a APN 13 59703735 missense probably benign 0.44
IGL02983:Spata31d1a APN 13 59703694 missense possibly damaging 0.65
IGL03224:Spata31d1a APN 13 59701026 missense possibly damaging 0.85
PIT1430001:Spata31d1a UTSW 13 59701196 missense probably benign
R0302:Spata31d1a UTSW 13 59703150 missense probably benign
R0387:Spata31d1a UTSW 13 59703501 missense probably damaging 0.99
R0464:Spata31d1a UTSW 13 59701759 missense possibly damaging 0.85
R0606:Spata31d1a UTSW 13 59702431 missense probably benign 0.03
R0617:Spata31d1a UTSW 13 59702259 missense possibly damaging 0.53
R0691:Spata31d1a UTSW 13 59700385 missense possibly damaging 0.93
R0746:Spata31d1a UTSW 13 59702263 missense possibly damaging 0.95
R1019:Spata31d1a UTSW 13 59702368 missense probably benign
R1397:Spata31d1a UTSW 13 59705039 splice site probably benign
R1543:Spata31d1a UTSW 13 59702242 missense probably benign
R1619:Spata31d1a UTSW 13 59702433 nonsense probably null
R1799:Spata31d1a UTSW 13 59703402 missense probably benign
R1820:Spata31d1a UTSW 13 59701255 missense possibly damaging 0.86
R1885:Spata31d1a UTSW 13 59702007 missense probably damaging 0.99
R1909:Spata31d1a UTSW 13 59702695 missense probably damaging 0.99
R2012:Spata31d1a UTSW 13 59702556 missense possibly damaging 0.93
R2099:Spata31d1a UTSW 13 59706071 missense probably damaging 0.97
R2132:Spata31d1a UTSW 13 59701043 missense probably damaging 0.96
R2224:Spata31d1a UTSW 13 59703715 missense probably benign
R2225:Spata31d1a UTSW 13 59703715 missense probably benign
R2226:Spata31d1a UTSW 13 59703715 missense probably benign
R2358:Spata31d1a UTSW 13 59703888 missense probably benign 0.00
R2495:Spata31d1a UTSW 13 59701993 missense possibly damaging 0.93
R3081:Spata31d1a UTSW 13 59703093 missense probably benign 0.15
R3151:Spata31d1a UTSW 13 59701366 missense probably benign 0.06
R3971:Spata31d1a UTSW 13 59702157 missense possibly damaging 0.85
R4156:Spata31d1a UTSW 13 59705047 missense possibly damaging 0.92
R4760:Spata31d1a UTSW 13 59701645 missense probably damaging 1.00
R4767:Spata31d1a UTSW 13 59701155 missense probably benign 0.03
R4877:Spata31d1a UTSW 13 59702523 missense probably damaging 0.99
R4894:Spata31d1a UTSW 13 59701728 missense probably damaging 0.98
R4961:Spata31d1a UTSW 13 59701902 missense possibly damaging 0.86
R4990:Spata31d1a UTSW 13 59703151 missense probably benign 0.00
R4991:Spata31d1a UTSW 13 59703151 missense probably benign 0.00
R4992:Spata31d1a UTSW 13 59703151 missense probably benign 0.00
R5088:Spata31d1a UTSW 13 59701152 splice site probably null
R5094:Spata31d1a UTSW 13 59705044 critical splice donor site probably null
R5330:Spata31d1a UTSW 13 59700403 missense possibly damaging 0.86
R5587:Spata31d1a UTSW 13 59702618 missense probably damaging 0.96
R5832:Spata31d1a UTSW 13 59701566 missense probably damaging 0.98
R6073:Spata31d1a UTSW 13 59702994 missense probably damaging 0.98
R6208:Spata31d1a UTSW 13 59700564 missense probably damaging 0.98
R6224:Spata31d1a UTSW 13 59706320 start gained probably benign
R6250:Spata31d1a UTSW 13 59701801 missense possibly damaging 0.93
R6359:Spata31d1a UTSW 13 59703106 missense probably benign
R6806:Spata31d1a UTSW 13 59703218 missense probably benign
R6848:Spata31d1a UTSW 13 59701963 missense possibly damaging 0.91
R6851:Spata31d1a UTSW 13 59703911 missense unknown
R6985:Spata31d1a UTSW 13 59703093 missense probably benign 0.15
R7007:Spata31d1a UTSW 13 59703634 missense probably benign
R7037:Spata31d1a UTSW 13 59700324 missense possibly damaging 0.96
R7124:Spata31d1a UTSW 13 59702487 missense probably damaging 0.99
R7271:Spata31d1a UTSW 13 59702099 missense probably benign 0.00
R7346:Spata31d1a UTSW 13 59703201 missense probably benign
R7556:Spata31d1a UTSW 13 59701984 missense probably benign 0.00
R7891:Spata31d1a UTSW 13 59700325 missense possibly damaging 0.96
R7995:Spata31d1a UTSW 13 59701110 missense probably benign 0.06
R8379:Spata31d1a UTSW 13 59702854 missense probably benign 0.00
Z1177:Spata31d1a UTSW 13 59703085 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTGTTACATACGCGACAACGG -3'
(R):5'- ACTTGTCACCATCTGCAGGTTC -3'

Sequencing Primer
(F):5'- ACGGGGATCTGGGCATAGC -3'
(R):5'- AGTGCTTTGAACCACTGAGC -3'
Posted On2019-10-24