Incidental Mutation 'R7581:Afdn'
ID 586765
Institutional Source Beutler Lab
Gene Symbol Afdn
Ensembl Gene ENSMUSG00000068036
Gene Name afadin, adherens junction formation factor
Synonyms Afadin, I-afadin, AF6, Mllt4, S-afadin, 5033403D15Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R7581 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 13760539-13906150 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 13849238 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 723 (V723A)
Ref Sequence ENSEMBL: ENSMUSP00000118318 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000137708] [ENSMUST00000137784] [ENSMUST00000139666] [ENSMUST00000150848] [ENSMUST00000170827]
AlphaFold Q9QZQ1
PDB Structure Solution structure of the FHA domain of mouse Afadin 6 [SOLUTION NMR]
Solution Structure of Ras-binding Domain in Mouse AF-6 Protein [SOLUTION NMR]
Crystal structure of afadin PDZ domain in complex with the C-terminal peptide from nectin-3 [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000137708
AA Change: V723A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000114485
Gene: ENSMUSG00000068036
AA Change: V723A

DomainStartEndE-ValueType
RA 39 133 5.88e-29 SMART
coiled coil region 146 186 N/A INTRINSIC
RA 246 348 1.56e-24 SMART
FHA 425 477 1.24e-5 SMART
DIL 785 891 4.11e-39 SMART
PDZ 1016 1093 8.07e-19 SMART
low complexity region 1309 1318 N/A INTRINSIC
low complexity region 1386 1392 N/A INTRINSIC
coiled coil region 1409 1447 N/A INTRINSIC
coiled coil region 1523 1563 N/A INTRINSIC
low complexity region 1575 1587 N/A INTRINSIC
coiled coil region 1616 1660 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000137784
AA Change: V730A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000119153
Gene: ENSMUSG00000068036
AA Change: V730A

DomainStartEndE-ValueType
RA 39 133 5.88e-29 SMART
coiled coil region 146 186 N/A INTRINSIC
RA 246 348 1.56e-24 SMART
FHA 425 477 1.24e-5 SMART
DIL 792 898 4.11e-39 SMART
PDZ 1023 1100 8.07e-19 SMART
low complexity region 1316 1325 N/A INTRINSIC
low complexity region 1393 1399 N/A INTRINSIC
coiled coil region 1416 1454 N/A INTRINSIC
coiled coil region 1530 1570 N/A INTRINSIC
low complexity region 1582 1594 N/A INTRINSIC
coiled coil region 1600 1672 N/A INTRINSIC
low complexity region 1699 1713 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000139666
AA Change: V723A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000118318
Gene: ENSMUSG00000068036
AA Change: V723A

DomainStartEndE-ValueType
RA 39 133 5.88e-29 SMART
coiled coil region 146 186 N/A INTRINSIC
RA 246 348 1.56e-24 SMART
FHA 425 477 1.24e-5 SMART
DIL 785 891 4.11e-39 SMART
PDZ 1016 1093 8.07e-19 SMART
low complexity region 1309 1318 N/A INTRINSIC
low complexity region 1386 1392 N/A INTRINSIC
coiled coil region 1409 1447 N/A INTRINSIC
coiled coil region 1523 1563 N/A INTRINSIC
low complexity region 1575 1587 N/A INTRINSIC
coiled coil region 1593 1665 N/A INTRINSIC
low complexity region 1692 1706 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000150848
AA Change: V708A

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000122447
Gene: ENSMUSG00000068036
AA Change: V708A

DomainStartEndE-ValueType
RA 39 133 5.88e-29 SMART
coiled coil region 146 186 N/A INTRINSIC
RA 246 348 1.56e-24 SMART
FHA 410 462 1.24e-5 SMART
DIL 770 876 4.11e-39 SMART
PDZ 1001 1078 8.07e-19 SMART
low complexity region 1294 1303 N/A INTRINSIC
low complexity region 1371 1377 N/A INTRINSIC
coiled coil region 1394 1432 N/A INTRINSIC
coiled coil region 1508 1548 N/A INTRINSIC
low complexity region 1560 1572 N/A INTRINSIC
coiled coil region 1578 1650 N/A INTRINSIC
low complexity region 1677 1691 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000170827
AA Change: V708A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000128891
Gene: ENSMUSG00000068036
AA Change: V708A

DomainStartEndE-ValueType
RA 39 133 5.88e-29 SMART
coiled coil region 146 186 N/A INTRINSIC
RA 246 348 1.56e-24 SMART
FHA 410 462 1.24e-5 SMART
DIL 770 876 4.11e-39 SMART
PDZ 1001 1078 8.07e-19 SMART
low complexity region 1294 1303 N/A INTRINSIC
low complexity region 1371 1377 N/A INTRINSIC
coiled coil region 1394 1432 N/A INTRINSIC
coiled coil region 1508 1548 N/A INTRINSIC
low complexity region 1560 1572 N/A INTRINSIC
coiled coil region 1578 1650 N/A INTRINSIC
low complexity region 1677 1691 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 98% (47/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a multi-domain protein involved in signaling and organization of cell junctions during embryogenesis. It has also been identified as the fusion partner of acute lymphoblastic leukemia (ALL-1) gene, involved in acute myeloid leukemias with t(6;11)(q27;q23) translocation. Alternatively spliced transcript variants encoding different isoforms have been described for this gene, however, not all have been fully characterized.[provided by RefSeq, May 2011]
PHENOTYPE: Homozygous null mice display embryonic lethality, abnormal ectoderm development including disrupted cell junctions, and absence of the somites, notochord, allantois, and neural folds. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430403G16Rik G A 5: 109,690,788 probably benign Het
Adamts9 A C 6: 92,937,338 D196E probably benign Het
Adnp A T 2: 168,183,466 D636E probably damaging Het
Arid1a A T 4: 133,680,351 F1897I unknown Het
Atp6v0b T C 4: 117,885,286 M137V probably benign Het
Bicd1 T A 6: 149,519,004 I784N probably damaging Het
Cckbr A G 7: 105,433,786 T119A probably benign Het
Creb5 T C 6: 53,681,237 L184P probably damaging Het
Cyp2a22 T G 7: 26,938,148 K141Q possibly damaging Het
D16Ertd472e T C 16: 78,546,557 T219A possibly damaging Het
Ep400 A T 5: 110,756,025 L236Q unknown Het
Exph5 A G 9: 53,372,557 S313G possibly damaging Het
Gm10024 T C 10: 77,711,563 V36A unknown Het
Gm5493 A G 17: 22,747,274 E44G probably damaging Het
Gtdc1 A T 2: 44,790,005 probably null Het
Invs T C 4: 48,421,909 V847A probably benign Het
Kif18b C A 11: 102,914,722 Q236H probably damaging Het
Kntc1 A G 5: 123,816,755 T2079A probably benign Het
Large2 A G 2: 92,370,193 S89P probably damaging Het
Maml3 A C 3: 51,856,768 D258E probably benign Het
Mdga2 A T 12: 66,506,255 M868K probably damaging Het
Mtss1l A G 8: 110,726,213 E30G possibly damaging Het
Muc16 T C 9: 18,645,614 I3128V unknown Het
Mug2 C T 6: 122,063,711 T740I probably damaging Het
Noc2l T C 4: 156,245,449 V612A probably benign Het
Olfr420 G A 1: 174,158,771 probably null Het
Olfr979 A T 9: 40,000,422 D268E probably damaging Het
Padi6 T C 4: 140,728,929 T585A probably benign Het
Pcdhga1 A T 18: 37,662,177 N78I probably damaging Het
Pdgfd A G 9: 6,293,894 Y156C probably damaging Het
Peg10 GCACATCAGGATCC GCACATCAGGATCCCCATCAGGATCCTCCACATCAGGATCC 6: 4,756,452 probably benign Het
Pi4ka C T 16: 17,301,060 V1307I Het
Pip5k1c A G 10: 81,308,960 N212D probably damaging Het
Plekha1 A G 7: 130,910,865 T264A probably benign Het
Polr2b A G 5: 77,326,704 R463G probably damaging Het
Psd2 T G 18: 35,979,997 D248E probably benign Het
Rag1 G T 2: 101,643,304 Q498K possibly damaging Het
Ryr3 A G 2: 112,753,027 I2853T probably damaging Het
Selenow G T 7: 15,922,382 probably null Het
Sned1 C T 1: 93,256,545 S165F probably benign Het
Spata31d1a A G 13: 59,704,139 probably null Het
Taar4 C A 10: 23,961,154 H221N probably damaging Het
Tgm6 A T 2: 130,141,285 R265W probably damaging Het
Trpm1 A T 7: 64,204,555 Q275L probably benign Het
Ulk3 T C 9: 57,592,042 L173P probably damaging Het
Urah A T 7: 140,835,627 T3S probably benign Het
Vmn1r149 A T 7: 22,437,904 V109D probably damaging Het
Xpc A T 6: 91,498,017 probably benign Het
Zglp1 T A 9: 21,062,708 K227N probably damaging Het
Other mutations in Afdn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00585:Afdn APN 17 13884628 missense probably damaging 1.00
IGL00784:Afdn APN 17 13849263 splice site probably benign
IGL00971:Afdn APN 17 13852313 splice site probably benign
IGL01403:Afdn APN 17 13903870 missense probably damaging 1.00
IGL01944:Afdn APN 17 13810481 missense probably damaging 1.00
IGL02474:Afdn APN 17 13818229 missense probably damaging 1.00
IGL02615:Afdn APN 17 13825976 missense probably benign 0.00
IGL02664:Afdn APN 17 13852466 splice site probably benign
IGL03036:Afdn APN 17 13888088 missense probably benign 0.12
jubilee UTSW 17 13887986 missense probably damaging 1.00
IGL03134:Afdn UTSW 17 13846286 missense probably benign 0.04
R0112:Afdn UTSW 17 13884637 missense probably damaging 1.00
R0226:Afdn UTSW 17 13899146 missense probably benign 0.00
R0305:Afdn UTSW 17 13888514 splice site probably null
R0310:Afdn UTSW 17 13885508 critical splice donor site probably null
R0711:Afdn UTSW 17 13852436 missense probably damaging 1.00
R0828:Afdn UTSW 17 13903998 missense probably damaging 1.00
R1268:Afdn UTSW 17 13887986 missense probably damaging 1.00
R1317:Afdn UTSW 17 13846273 missense probably benign 0.11
R1386:Afdn UTSW 17 13846536 missense probably damaging 1.00
R1438:Afdn UTSW 17 13855390 missense probably damaging 1.00
R1607:Afdn UTSW 17 13810501 missense probably damaging 1.00
R1819:Afdn UTSW 17 13850848 missense probably damaging 1.00
R1872:Afdn UTSW 17 13881316 missense probably damaging 1.00
R1880:Afdn UTSW 17 13852353 missense possibly damaging 0.84
R2049:Afdn UTSW 17 13810433 missense probably damaging 0.96
R2140:Afdn UTSW 17 13810433 missense probably damaging 0.96
R2142:Afdn UTSW 17 13810433 missense probably damaging 0.96
R2162:Afdn UTSW 17 13896174 missense probably benign 0.01
R2221:Afdn UTSW 17 13883737 splice site probably benign
R2223:Afdn UTSW 17 13883737 splice site probably benign
R2291:Afdn UTSW 17 13888891 missense probably damaging 1.00
R2993:Afdn UTSW 17 13891000 critical splice donor site probably null
R3402:Afdn UTSW 17 13883914 missense probably damaging 1.00
R3403:Afdn UTSW 17 13883914 missense probably damaging 1.00
R3690:Afdn UTSW 17 13888409 missense probably damaging 1.00
R3691:Afdn UTSW 17 13888409 missense probably damaging 1.00
R3764:Afdn UTSW 17 13846589 missense probably benign 0.07
R3832:Afdn UTSW 17 13896174 missense probably benign 0.01
R4002:Afdn UTSW 17 13883917 missense probably damaging 1.00
R4440:Afdn UTSW 17 13850890 missense probably damaging 1.00
R4621:Afdn UTSW 17 13888820 missense probably damaging 1.00
R4935:Afdn UTSW 17 13890966 missense probably benign 0.30
R5279:Afdn UTSW 17 13888952 missense probably damaging 1.00
R5421:Afdn UTSW 17 13832406 missense probably benign 0.25
R5689:Afdn UTSW 17 13855359 missense probably damaging 1.00
R6332:Afdn UTSW 17 13810445 missense possibly damaging 0.92
R6369:Afdn UTSW 17 13835343 nonsense probably null
R6433:Afdn UTSW 17 13881299 missense probably damaging 1.00
R6467:Afdn UTSW 17 13804053 missense probably damaging 1.00
R6500:Afdn UTSW 17 13822372 missense possibly damaging 0.67
R6564:Afdn UTSW 17 13896089 missense probably benign
R6705:Afdn UTSW 17 13888021 missense probably benign 0.01
R6733:Afdn UTSW 17 13823353 missense probably benign 0.39
R6983:Afdn UTSW 17 13881321 missense probably damaging 1.00
R7089:Afdn UTSW 17 13890812 splice site probably null
R7161:Afdn UTSW 17 13888946 missense possibly damaging 0.55
R7175:Afdn UTSW 17 13888607 missense probably damaging 1.00
R7492:Afdn UTSW 17 13848376 critical splice donor site probably null
R7567:Afdn UTSW 17 13888808 missense probably benign 0.19
R7694:Afdn UTSW 17 13888882 missense probably damaging 0.99
R7722:Afdn UTSW 17 13808969 missense probably benign 0.40
R7794:Afdn UTSW 17 13882433 missense probably damaging 1.00
R8039:Afdn UTSW 17 13899141 missense probably damaging 0.99
R8444:Afdn UTSW 17 13883800 missense probably benign 0.31
R8694:Afdn UTSW 17 13888379 missense probably benign
R8728:Afdn UTSW 17 13898945 missense probably damaging 1.00
R8770:Afdn UTSW 17 13883937 critical splice donor site probably null
R8887:Afdn UTSW 17 13896139 nonsense probably null
R9101:Afdn UTSW 17 13823444 missense probably damaging 0.99
R9169:Afdn UTSW 17 13852365 missense probably benign 0.02
R9275:Afdn UTSW 17 13804008 missense probably damaging 1.00
R9276:Afdn UTSW 17 13804008 missense probably damaging 1.00
R9277:Afdn UTSW 17 13804008 missense probably damaging 1.00
R9278:Afdn UTSW 17 13804008 missense probably damaging 1.00
R9281:Afdn UTSW 17 13804008 missense probably damaging 1.00
R9573:Afdn UTSW 17 13829967 missense not run
X0060:Afdn UTSW 17 13818170 nonsense probably null
X0064:Afdn UTSW 17 13888027 missense possibly damaging 0.60
Z1088:Afdn UTSW 17 13883780 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TATCTTCAGCTTCTCAGGAACATTC -3'
(R):5'- GCAGTTGTTCCAGAGCACAC -3'

Sequencing Primer
(F):5'- ATTTGTAATTTTTCTGATGCCTTGC -3'
(R):5'- GCACACTGCTCTTAAGTTAACAC -3'
Posted On 2019-10-24