Incidental Mutation 'R0621:Dctn2'
ID58678
Institutional Source Beutler Lab
Gene Symbol Dctn2
Ensembl Gene ENSMUSG00000025410
Gene Namedynactin 2
SynonymsRBP50, p50, DCTN-50, C130077D06Rik, 2310042E05Rik
MMRRC Submission 038810-MU
Accession Numbers

Ncbi RefSeq: NM_001190454.1, NM_001190453.1, NM_027151.2; MGI:107733

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0621 (G1)
Quality Score211
Status Not validated
Chromosome10
Chromosomal Location127266368-127281950 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 127277940 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000026479 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026476] [ENSMUST00000026479] [ENSMUST00000119078]
Predicted Effect probably benign
Transcript: ENSMUST00000026476
SMART Domains Protein: ENSMUSP00000026476
Gene: ENSMUSG00000025409

DomainStartEndE-ValueType
Blast:MBD 26 79 8e-10 BLAST
low complexity region 80 94 N/A INTRINSIC
low complexity region 140 155 N/A INTRINSIC
low complexity region 183 197 N/A INTRINSIC
low complexity region 212 229 N/A INTRINSIC
low complexity region 247 262 N/A INTRINSIC
low complexity region 269 295 N/A INTRINSIC
low complexity region 311 342 N/A INTRINSIC
low complexity region 347 378 N/A INTRINSIC
low complexity region 383 428 N/A INTRINSIC
low complexity region 442 455 N/A INTRINSIC
low complexity region 461 498 N/A INTRINSIC
low complexity region 500 517 N/A INTRINSIC
low complexity region 533 563 N/A INTRINSIC
low complexity region 566 634 N/A INTRINSIC
low complexity region 636 652 N/A INTRINSIC
low complexity region 653 674 N/A INTRINSIC
low complexity region 676 686 N/A INTRINSIC
low complexity region 733 799 N/A INTRINSIC
low complexity region 815 849 N/A INTRINSIC
low complexity region 853 890 N/A INTRINSIC
low complexity region 949 958 N/A INTRINSIC
low complexity region 978 1002 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000026479
SMART Domains Protein: ENSMUSP00000026479
Gene: ENSMUSG00000025410

DomainStartEndE-ValueType
Pfam:Dynamitin 16 400 7.1e-129 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000119078
SMART Domains Protein: ENSMUSP00000112805
Gene: ENSMUSG00000025409

DomainStartEndE-ValueType
Blast:MBD 26 79 8e-10 BLAST
low complexity region 80 94 N/A INTRINSIC
low complexity region 140 155 N/A INTRINSIC
low complexity region 183 197 N/A INTRINSIC
low complexity region 212 229 N/A INTRINSIC
low complexity region 247 262 N/A INTRINSIC
low complexity region 269 295 N/A INTRINSIC
low complexity region 311 342 N/A INTRINSIC
low complexity region 347 378 N/A INTRINSIC
low complexity region 383 428 N/A INTRINSIC
low complexity region 442 455 N/A INTRINSIC
low complexity region 461 498 N/A INTRINSIC
low complexity region 500 517 N/A INTRINSIC
low complexity region 533 563 N/A INTRINSIC
low complexity region 566 634 N/A INTRINSIC
low complexity region 636 652 N/A INTRINSIC
low complexity region 653 674 N/A INTRINSIC
low complexity region 676 686 N/A INTRINSIC
low complexity region 733 798 N/A INTRINSIC
low complexity region 813 847 N/A INTRINSIC
low complexity region 851 888 N/A INTRINSIC
low complexity region 947 956 N/A INTRINSIC
low complexity region 976 1000 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000126243
SMART Domains Protein: ENSMUSP00000115238
Gene: ENSMUSG00000025409

DomainStartEndE-ValueType
low complexity region 1 26 N/A INTRINSIC
low complexity region 31 76 N/A INTRINSIC
low complexity region 90 103 N/A INTRINSIC
low complexity region 109 146 N/A INTRINSIC
low complexity region 148 165 N/A INTRINSIC
low complexity region 181 211 N/A INTRINSIC
low complexity region 214 282 N/A INTRINSIC
low complexity region 284 300 N/A INTRINSIC
low complexity region 301 322 N/A INTRINSIC
low complexity region 324 334 N/A INTRINSIC
low complexity region 381 446 N/A INTRINSIC
low complexity region 462 496 N/A INTRINSIC
low complexity region 500 537 N/A INTRINSIC
low complexity region 596 610 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000136169
SMART Domains Protein: ENSMUSP00000122504
Gene: ENSMUSG00000025409

DomainStartEndE-ValueType
low complexity region 55 64 N/A INTRINSIC
low complexity region 84 108 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000154851
SMART Domains Protein: ENSMUSP00000133835
Gene: ENSMUSG00000025409

DomainStartEndE-ValueType
low complexity region 2 61 N/A INTRINSIC
low complexity region 72 81 N/A INTRINSIC
low complexity region 101 125 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218556
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218752
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220418
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 99.0%
  • 10x: 97.8%
  • 20x: 96.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a 50-kD subunit of dynactin, a macromolecular complex consisting of 10-11 subunits ranging in size from 22 to 150 kD. Dynactin binds to both microtubules and cytoplasmic dynein. It is involved in a diverse array of cellular functions, including ER-to-Golgi transport, the centripetal movement of lysosomes and endosomes, spindle formation, chromosome movement, nuclear positioning, and axonogenesis. This subunit is present in 4-5 copies per dynactin molecule. It contains three short alpha-helical coiled-coil domains that may mediate association with self or other dynactin subunits. It may interact directly with the largest subunit (p150) of dynactin and may affix p150 in place. Multiple alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, May 2012]
Allele List at MGI

All alleles(28) : Targeted(3) Gene trapped(25)

Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abr T C 11: 76,509,072 D33G probably damaging Het
Adgre1 T A 17: 57,441,359 S520T probably damaging Het
Ankrd40 A G 11: 94,339,607 probably null Het
Aph1b A T 9: 66,779,334 I177K possibly damaging Het
Armc3 A T 2: 19,295,393 N579I probably damaging Het
Atxn7l1 T C 12: 33,326,100 V131A probably benign Het
C130073F10Rik A G 4: 101,890,795 Y61H probably damaging Het
C1s2 A T 6: 124,631,112 L214Q probably damaging Het
Caprin2 A T 6: 148,858,678 S425T possibly damaging Het
Cdc42ep4 G A 11: 113,728,696 R290C probably damaging Het
Cenpf T C 1: 189,672,628 T352A probably benign Het
Col6a4 A T 9: 106,066,791 F1161L probably damaging Het
Ddx24 T C 12: 103,425,558 probably benign Het
Dsg1c C A 18: 20,279,695 A591D possibly damaging Het
Efnb3 T C 11: 69,555,972 D304G probably damaging Het
Erbb3 T C 10: 128,586,225 Y50C probably benign Het
Eya3 T G 4: 132,694,802 D275E probably benign Het
Fam81a G T 9: 70,093,647 Q272K probably benign Het
Foxf1 T C 8: 121,085,180 V261A probably damaging Het
Gm9637 G A 14: 19,402,011 noncoding transcript Het
Gnb4 C T 3: 32,591,207 V112I probably benign Het
Gtf2h2 A T 13: 100,488,925 L61Q probably damaging Het
Hey2 T A 10: 30,834,386 I124F probably benign Het
Hoxb3 A T 11: 96,345,963 Y289F probably damaging Het
Kctd3 C T 1: 188,981,341 R399Q probably damaging Het
Kif26b C G 1: 178,915,653 P1105A probably benign Het
Klhl30 C T 1: 91,357,863 T369M probably damaging Het
Lipo2 C T 19: 33,730,939 G225D probably damaging Het
Macf1 T C 4: 123,380,534 K6350E probably damaging Het
Myh13 A C 11: 67,341,232 N446T probably damaging Het
Nos1ap T C 1: 170,318,581 D468G probably damaging Het
Olfr1250 C A 2: 89,657,115 E109* probably null Het
Olfr418 C T 1: 173,270,675 P167S possibly damaging Het
Olfr746 G A 14: 50,653,962 G242R possibly damaging Het
Pde3a T C 6: 141,249,999 L137P probably damaging Het
Ppm1f G A 16: 16,915,308 R233Q probably benign Het
Rtf2 C A 2: 172,466,296 A205E possibly damaging Het
Sh2d5 T C 4: 138,258,318 F359S probably benign Het
Siglec1 G A 2: 131,074,268 T1254M probably benign Het
Slc39a11 G A 11: 113,464,079 P108L probably benign Het
Slc6a5 G A 7: 49,917,365 probably null Het
Snph C T 2: 151,593,722 V360M probably damaging Het
Snx29 A G 16: 11,405,787 probably null Het
Sos1 A G 17: 80,451,979 probably null Het
Spata5 C T 3: 37,432,029 T300I probably benign Het
St8sia6 T A 2: 13,657,282 N246I probably damaging Het
Thy1 T A 9: 44,046,733 F53I probably damaging Het
Tle3 T A 9: 61,410,105 Y421* probably null Het
Ttc21b C T 2: 66,226,011 R677Q probably benign Het
Vmn2r107 A T 17: 20,374,990 I602F probably benign Het
Wdr17 C A 8: 54,643,191 G1016C probably benign Het
Wdr62 T C 7: 30,254,061 E182G possibly damaging Het
Zfp597 A G 16: 3,866,364 I176T probably benign Het
Other mutations in Dctn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00334:Dctn2 APN 10 127277690 unclassified probably benign
IGL01749:Dctn2 APN 10 127281417 missense possibly damaging 0.47
IGL01797:Dctn2 APN 10 127277313 missense possibly damaging 0.94
IGL02021:Dctn2 APN 10 127275057 critical splice donor site probably null
IGL02335:Dctn2 APN 10 127275821 splice site probably benign
IGL02748:Dctn2 APN 10 127277273 missense probably damaging 1.00
IGL03382:Dctn2 APN 10 127278188 missense probably damaging 0.99
R0069:Dctn2 UTSW 10 127277485 unclassified probably null
R0069:Dctn2 UTSW 10 127277485 unclassified probably null
R1114:Dctn2 UTSW 10 127278142 unclassified probably null
R1917:Dctn2 UTSW 10 127275049 nonsense probably null
R2238:Dctn2 UTSW 10 127276388 missense probably damaging 0.97
R4097:Dctn2 UTSW 10 127277493 missense probably damaging 1.00
R4418:Dctn2 UTSW 10 127278365 missense probably benign 0.24
R4972:Dctn2 UTSW 10 127276703 missense probably damaging 1.00
R6873:Dctn2 UTSW 10 127276236 intron probably null
R7533:Dctn2 UTSW 10 127267478 missense possibly damaging 0.87
R7557:Dctn2 UTSW 10 127278404 missense probably benign 0.44
R7657:Dctn2 UTSW 10 127266514 missense probably damaging 1.00
R8218:Dctn2 UTSW 10 127276529 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- GTTGCAAGCCAAAGTGAGTGCC -3'
(R):5'- AAGTCGCTGTACCAGTTCAGGGAG -3'

Sequencing Primer
(F):5'- TTCTGGACCAAGTAGAGGCTC -3'
(R):5'- CGCTGGATGGTCTCATAGAGC -3'
Posted On2013-07-11