Incidental Mutation 'R0621:Efnb3'
ID58682
Institutional Source Beutler Lab
Gene Symbol Efnb3
Ensembl Gene ENSMUSG00000003934
Gene Nameephrin B3
SynonymsEpl8, EFL-6, Elk-L3, ELF-3, LERK-8, NLERK-2
MMRRC Submission 038810-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0621 (G1)
Quality Score169
Status Not validated
Chromosome11
Chromosomal Location69554092-69560205 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 69555972 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 304 (D304G)
Ref Sequence ENSEMBL: ENSMUSP00000004036 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004036]
PDB Structure
Crystal Structures of Nipah Virus G Attachment Glycoprotein in Complex with its Receptor Ephrin-B3 [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000004036
AA Change: D304G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000004036
Gene: ENSMUSG00000003934
AA Change: D304G

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:Ephrin 28 167 2.8e-45 PFAM
transmembrane domain 225 247 N/A INTRINSIC
low complexity region 264 291 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 99.0%
  • 10x: 97.8%
  • 20x: 96.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] EFNB3, a member of the ephrin gene family, is important in brain development as well as in its maintenance. Moreover, since levels of EFNB3 expression were particularly high in several forebrain subregions compared to other brain subregions, it may play a pivotal role in forebrain function. The EPH and EPH-related receptors comprise the largest subfamily of receptor protein-tyrosine kinases and have been implicated in mediating developmental events, particularly in the nervous system. EPH Receptors typically have a single kinase domain and an extracellular region containing a Cys-rich domain and 2 fibronectin type III repeats. The ephrin ligands and receptors have been named by the Eph Nomenclature Committee (1997). Based on their structures and sequence relationships, ephrins are divided into the ephrin-A (EFNA) class, which are anchored to the membrane by a glycosylphosphatidylinositol linkage, and the ephrin-B (EFNB) class, which are transmembrane proteins. The Eph family of receptors are similarly divided into 2 groups based on the similarity of their extracellular domain sequences and their affinities for binding ephrin-A and ephrin-B ligands. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for null mutations exhibit a hopping gait due to corticospinal tract defects, mutations that remove only the cytoplasmic domain of the protein do not result in the gait or CNS phenotypes, and a G244E mutation causes ataxia [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abr T C 11: 76,509,072 D33G probably damaging Het
Adgre1 T A 17: 57,441,359 S520T probably damaging Het
Ankrd40 A G 11: 94,339,607 probably null Het
Aph1b A T 9: 66,779,334 I177K possibly damaging Het
Armc3 A T 2: 19,295,393 N579I probably damaging Het
Atxn7l1 T C 12: 33,326,100 V131A probably benign Het
C130073F10Rik A G 4: 101,890,795 Y61H probably damaging Het
C1s2 A T 6: 124,631,112 L214Q probably damaging Het
Caprin2 A T 6: 148,858,678 S425T possibly damaging Het
Cdc42ep4 G A 11: 113,728,696 R290C probably damaging Het
Cenpf T C 1: 189,672,628 T352A probably benign Het
Col6a4 A T 9: 106,066,791 F1161L probably damaging Het
Dctn2 T C 10: 127,277,940 probably null Het
Ddx24 T C 12: 103,425,558 probably benign Het
Dsg1c C A 18: 20,279,695 A591D possibly damaging Het
Erbb3 T C 10: 128,586,225 Y50C probably benign Het
Eya3 T G 4: 132,694,802 D275E probably benign Het
Fam81a G T 9: 70,093,647 Q272K probably benign Het
Foxf1 T C 8: 121,085,180 V261A probably damaging Het
Gm9637 G A 14: 19,402,011 noncoding transcript Het
Gnb4 C T 3: 32,591,207 V112I probably benign Het
Gtf2h2 A T 13: 100,488,925 L61Q probably damaging Het
Hey2 T A 10: 30,834,386 I124F probably benign Het
Hoxb3 A T 11: 96,345,963 Y289F probably damaging Het
Kctd3 C T 1: 188,981,341 R399Q probably damaging Het
Kif26b C G 1: 178,915,653 P1105A probably benign Het
Klhl30 C T 1: 91,357,863 T369M probably damaging Het
Lipo2 C T 19: 33,730,939 G225D probably damaging Het
Macf1 T C 4: 123,380,534 K6350E probably damaging Het
Myh13 A C 11: 67,341,232 N446T probably damaging Het
Nos1ap T C 1: 170,318,581 D468G probably damaging Het
Olfr1250 C A 2: 89,657,115 E109* probably null Het
Olfr418 C T 1: 173,270,675 P167S possibly damaging Het
Olfr746 G A 14: 50,653,962 G242R possibly damaging Het
Pde3a T C 6: 141,249,999 L137P probably damaging Het
Ppm1f G A 16: 16,915,308 R233Q probably benign Het
Rtf2 C A 2: 172,466,296 A205E possibly damaging Het
Sh2d5 T C 4: 138,258,318 F359S probably benign Het
Siglec1 G A 2: 131,074,268 T1254M probably benign Het
Slc39a11 G A 11: 113,464,079 P108L probably benign Het
Slc6a5 G A 7: 49,917,365 probably null Het
Snph C T 2: 151,593,722 V360M probably damaging Het
Snx29 A G 16: 11,405,787 probably null Het
Sos1 A G 17: 80,451,979 probably null Het
Spata5 C T 3: 37,432,029 T300I probably benign Het
St8sia6 T A 2: 13,657,282 N246I probably damaging Het
Thy1 T A 9: 44,046,733 F53I probably damaging Het
Tle3 T A 9: 61,410,105 Y421* probably null Het
Ttc21b C T 2: 66,226,011 R677Q probably benign Het
Vmn2r107 A T 17: 20,374,990 I602F probably benign Het
Wdr17 C A 8: 54,643,191 G1016C probably benign Het
Wdr62 T C 7: 30,254,061 E182G possibly damaging Het
Zfp597 A G 16: 3,866,364 I176T probably benign Het
Other mutations in Efnb3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01995:Efnb3 APN 11 69556904 critical splice donor site probably null
IGL03114:Efnb3 APN 11 69556802 unclassified probably benign
IGL03328:Efnb3 APN 11 69557205 missense probably damaging 1.00
turtle UTSW 11 69557283 missense probably damaging 1.00
R4366:Efnb3 UTSW 11 69555945 missense probably damaging 1.00
R6215:Efnb3 UTSW 11 69556765 missense probably benign 0.05
R6356:Efnb3 UTSW 11 69556140 missense probably benign 0.01
R7638:Efnb3 UTSW 11 69557220 missense possibly damaging 0.53
Predicted Primers PCR Primer
(F):5'- GCAGGTGTCCCTCATACCATGAATTAC -3'
(R):5'- CCCAATATCCAGATGGTTCCTTCAGC -3'

Sequencing Primer
(F):5'- CTCATACCATGAATTACACTGGAGG -3'
(R):5'- GTGACCCCAGCAGCAATG -3'
Posted On2013-07-11