Incidental Mutation 'R7582:Cep128'
ID586820
Institutional Source Beutler Lab
Gene Symbol Cep128
Ensembl Gene ENSMUSG00000061533
Gene Namecentrosomal protein 128
Synonyms4930534B04Rik, 5430424K18Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.180) question?
Stock #R7582 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location90998492-91384409 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 91347566 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 146 (T146M)
Ref Sequence ENSEMBL: ENSMUSP00000115679 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000141429]
Predicted Effect probably damaging
Transcript: ENSMUST00000141429
AA Change: T146M

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000115679
Gene: ENSMUSG00000061533
AA Change: T146M

DomainStartEndE-ValueType
low complexity region 89 110 N/A INTRINSIC
coiled coil region 216 329 N/A INTRINSIC
low complexity region 340 352 N/A INTRINSIC
coiled coil region 377 822 N/A INTRINSIC
coiled coil region 876 960 N/A INTRINSIC
low complexity region 1091 1102 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgb A G 10: 10,390,821 V1007A probably damaging Het
Adgrl3 T C 5: 81,693,676 V800A probably damaging Het
Ankfn1 T A 11: 89,526,619 M56L probably benign Het
Arfgap3 A C 15: 83,303,101 V72G possibly damaging Het
B3galnt2 C T 13: 13,991,401 R294W probably damaging Het
Cadm1 G T 9: 47,797,442 D157Y probably damaging Het
Ccdc81 A T 7: 89,876,145 Y474N probably damaging Het
Cdkl4 T A 17: 80,533,835 K297I probably benign Het
Cfap161 T C 7: 83,777,082 N236S possibly damaging Het
Chil3 A T 3: 106,164,256 W31R probably damaging Het
Cmtm2b C T 8: 104,322,721 S86F probably damaging Het
Cntnap5a G A 1: 116,446,632 G958D probably damaging Het
Col6a5 A G 9: 105,945,426 L244P unknown Het
Crat C T 2: 30,404,565 R497Q probably benign Het
Cul9 A G 17: 46,510,979 Y1857H probably damaging Het
Dst A G 1: 34,169,883 Q1154R probably damaging Het
Fgg G A 3: 83,014,138 G376D probably damaging Het
Fmn2 T C 1: 174,698,790 S1392P probably damaging Het
Focad T C 4: 88,229,378 V418A probably benign Het
Foxf1 A T 8: 121,084,691 H98L possibly damaging Het
Frmd4a C CA 2: 4,594,597 probably null Het
Fry C A 5: 150,496,382 T639K Het
Fryl A G 5: 73,022,500 probably null Het
Gatsl3 T C 11: 4,220,457 V151A probably benign Het
Gdpd4 A G 7: 97,957,805 probably null Het
Gpt2 A G 8: 85,519,516 K368R probably damaging Het
Hc A T 2: 34,991,266 V1447E possibly damaging Het
Kmt5a A G 5: 124,459,919 T280A probably benign Het
Lrrc4b G T 7: 44,461,810 V369L probably benign Het
Ly6g5c A G 17: 35,111,807 M102V probably benign Het
Malrd1 A G 2: 15,695,270 S643G unknown Het
Mib2 T C 4: 155,654,810 N904S probably benign Het
Mug2 G A 6: 122,079,644 V1183I probably damaging Het
Nckap1l C T 15: 103,482,160 T786I probably damaging Het
Neb T C 2: 52,334,492 probably benign Het
Neu3 A G 7: 99,813,967 V183A probably benign Het
Nod1 A G 6: 54,944,307 L342P probably damaging Het
Nop58 T C 1: 59,700,938 V163A probably damaging Het
Npr3 C T 15: 11,895,682 G293R probably null Het
Obscn T A 11: 59,061,427 K3939* probably null Het
Olfr1279 T A 2: 111,306,448 M81K probably damaging Het
Olfr1426 G A 19: 12,088,006 A262V probably benign Het
Olfr180 A T 16: 58,916,047 M198K possibly damaging Het
Olfr502 A G 7: 108,523,851 I33T probably benign Het
Olfr875 T C 9: 37,772,821 L54P probably damaging Het
P2ry6 A G 7: 100,938,577 Y192H probably damaging Het
Paxbp1 A G 16: 91,022,667 probably null Het
Pign G A 1: 105,649,367 T197I probably benign Het
Pirb A T 7: 3,713,818 probably null Het
Pkdrej C A 15: 85,818,921 R938L possibly damaging Het
Psg21 A G 7: 18,647,203 *472R probably null Het
Rabgap1l A T 1: 160,682,084 S474R probably benign Het
Rrn3 C T 16: 13,810,511 Q519* probably null Het
Seh1l A T 18: 67,775,118 K37* probably null Het
Shprh A G 10: 11,164,705 S641G probably benign Het
Slc4a1 T G 11: 102,352,577 S743R probably damaging Het
Snx13 C T 12: 35,124,535 R688* probably null Het
Tlr11 C T 14: 50,361,729 Q391* probably null Het
Tmbim4 A G 10: 120,217,566 H90R probably benign Het
Trav8d-1 T C 14: 52,778,869 S71P possibly damaging Het
Trbv5 G A 6: 41,062,683 R74Q probably benign Het
Tril A G 6: 53,818,936 S434P probably benign Het
Uhmk1 A G 1: 170,200,001 Y376H probably damaging Het
Uty A G Y: 1,170,914 C317R probably damaging Het
Vmp1 C T 11: 86,585,399 C377Y probably benign Het
Vwa8 A C 14: 78,982,234 probably null Het
Wdr41 T C 13: 95,005,767 S150P probably damaging Het
Zfp617 T A 8: 71,932,020 Y65N probably benign Het
Zfp800 A C 6: 28,244,090 V292G probably damaging Het
Other mutations in Cep128
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00673:Cep128 APN 12 91234191 missense probably benign 0.17
IGL00800:Cep128 APN 12 91255664 missense possibly damaging 0.83
IGL01738:Cep128 APN 12 91230842 missense probably damaging 1.00
IGL01844:Cep128 APN 12 91008854 missense probably benign 0.14
IGL01918:Cep128 APN 12 91234210 missense probably damaging 0.99
IGL02043:Cep128 APN 12 91266730 splice site probably benign
IGL02405:Cep128 APN 12 91266986 missense probably benign 0.04
IGL02616:Cep128 APN 12 91296258 missense probably benign 0.03
PIT4260001:Cep128 UTSW 12 91299034 missense probably benign 0.00
R0416:Cep128 UTSW 12 91230867 splice site probably benign
R0442:Cep128 UTSW 12 91266771 missense probably damaging 1.00
R0608:Cep128 UTSW 12 90999535 utr 3 prime probably benign
R1108:Cep128 UTSW 12 91339109 missense probably damaging 1.00
R1178:Cep128 UTSW 12 91260155 missense probably damaging 1.00
R1183:Cep128 UTSW 12 91325598 missense possibly damaging 0.84
R1394:Cep128 UTSW 12 91266980 missense probably benign 0.07
R1395:Cep128 UTSW 12 91266980 missense probably benign 0.07
R1498:Cep128 UTSW 12 91366417 missense probably benign
R1541:Cep128 UTSW 12 91348781 missense probably damaging 1.00
R1639:Cep128 UTSW 12 91366368 missense probably damaging 1.00
R1643:Cep128 UTSW 12 91325532 missense probably damaging 1.00
R1682:Cep128 UTSW 12 91230822 missense probably damaging 0.99
R1739:Cep128 UTSW 12 91022491 splice site probably null
R1758:Cep128 UTSW 12 91347578 missense probably benign 0.02
R1845:Cep128 UTSW 12 91289598 missense probably benign 0.01
R1987:Cep128 UTSW 12 91230829 missense probably benign 0.01
R2017:Cep128 UTSW 12 91366464 missense probably damaging 0.98
R2237:Cep128 UTSW 12 91347567 missense probably benign 0.01
R2239:Cep128 UTSW 12 91347567 missense probably benign 0.01
R3103:Cep128 UTSW 12 91019344 missense probably damaging 0.99
R4552:Cep128 UTSW 12 91294162 missense probably damaging 0.98
R4664:Cep128 UTSW 12 91296253 missense probably damaging 1.00
R4774:Cep128 UTSW 12 91234195 missense probably damaging 0.99
R4838:Cep128 UTSW 12 90999545 utr 3 prime probably benign
R4858:Cep128 UTSW 12 91260162 missense probably benign 0.04
R4924:Cep128 UTSW 12 91022400 splice site silent
R5002:Cep128 UTSW 12 91255723 intron probably null
R5282:Cep128 UTSW 12 91339119 missense probably damaging 1.00
R5386:Cep128 UTSW 12 90999571 missense probably benign 0.03
R5476:Cep128 UTSW 12 91213618 missense probably damaging 0.96
R5643:Cep128 UTSW 12 91348851 missense probably damaging 1.00
R5644:Cep128 UTSW 12 91348851 missense probably damaging 1.00
R5668:Cep128 UTSW 12 90999636 missense probably benign 0.01
R6057:Cep128 UTSW 12 91296224 missense possibly damaging 0.92
R6831:Cep128 UTSW 12 91266974 missense probably damaging 0.99
R6852:Cep128 UTSW 12 91366342 critical splice donor site probably null
R7078:Cep128 UTSW 12 91234104 missense probably damaging 0.99
R7144:Cep128 UTSW 12 91294159 missense probably damaging 0.98
R7487:Cep128 UTSW 12 90999630 missense probably benign 0.05
R7713:Cep128 UTSW 12 91019322 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- TTGTCTGCACTAGGGTCTCC -3'
(R):5'- GGCTAAGAGTCCCTACATATCTCC -3'

Sequencing Primer
(F):5'- GCACTAGGGTCTCCTTAATCTTAGAG -3'
(R):5'- ACATATCTCCTTGTCTGGTCTGTAGG -3'
Posted On2019-10-24