Incidental Mutation 'R7582:B3galnt2'
ID586821
Institutional Source Beutler Lab
Gene Symbol B3galnt2
Ensembl Gene ENSMUSG00000039242
Gene NameUDP-GalNAc:betaGlcNAc beta 1,3-galactosaminyltransferase, polypeptide 2
SynonymsD230016N13Rik, A930105D20Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7582 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location13954469-13999103 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 13991401 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 294 (R294W)
Ref Sequence ENSEMBL: ENSMUSP00000097336 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099747] [ENSMUST00000220681] [ENSMUST00000221300] [ENSMUST00000221974] [ENSMUST00000222110] [ENSMUST00000223483]
Predicted Effect probably damaging
Transcript: ENSMUST00000099747
AA Change: R294W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000097336
Gene: ENSMUSG00000039242
AA Change: R294W

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Pfam:Galactosyl_T 300 460 2.9e-26 PFAM
low complexity region 481 492 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000220681
AA Change: R75W

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000221300
AA Change: R294W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000221333
Predicted Effect probably damaging
Transcript: ENSMUST00000221974
AA Change: R294W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000222110
Predicted Effect probably benign
Transcript: ENSMUST00000222420
Predicted Effect probably benign
Transcript: ENSMUST00000223483
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the glycosyltransferase 31 family. The encoded protein synthesizes GalNAc:beta-1,3GlcNAc, a novel carbohydrate structure, on N- and O-glycans. Alternatively spliced transcript variants that encode different isoforms have been described. [provided by RefSeq, Mar 2013]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgb A G 10: 10,390,821 V1007A probably damaging Het
Adgrl3 T C 5: 81,693,676 V800A probably damaging Het
Ankfn1 T A 11: 89,526,619 M56L probably benign Het
Arfgap3 A C 15: 83,303,101 V72G possibly damaging Het
Cadm1 G T 9: 47,797,442 D157Y probably damaging Het
Ccdc81 A T 7: 89,876,145 Y474N probably damaging Het
Cdkl4 T A 17: 80,533,835 K297I probably benign Het
Cep128 G A 12: 91,347,566 T146M probably damaging Het
Cfap161 T C 7: 83,777,082 N236S possibly damaging Het
Chil3 A T 3: 106,164,256 W31R probably damaging Het
Cmtm2b C T 8: 104,322,721 S86F probably damaging Het
Cntnap5a G A 1: 116,446,632 G958D probably damaging Het
Col6a5 A G 9: 105,945,426 L244P unknown Het
Crat C T 2: 30,404,565 R497Q probably benign Het
Cul9 A G 17: 46,510,979 Y1857H probably damaging Het
Dst A G 1: 34,169,883 Q1154R probably damaging Het
Fgg G A 3: 83,014,138 G376D probably damaging Het
Fmn2 T C 1: 174,698,790 S1392P probably damaging Het
Focad T C 4: 88,229,378 V418A probably benign Het
Foxf1 A T 8: 121,084,691 H98L possibly damaging Het
Frmd4a C CA 2: 4,594,597 probably null Het
Fry C A 5: 150,496,382 T639K Het
Fryl A G 5: 73,022,500 probably null Het
Gatsl3 T C 11: 4,220,457 V151A probably benign Het
Gdpd4 A G 7: 97,957,805 probably null Het
Gpt2 A G 8: 85,519,516 K368R probably damaging Het
Hc A T 2: 34,991,266 V1447E possibly damaging Het
Kmt5a A G 5: 124,459,919 T280A probably benign Het
Lrrc4b G T 7: 44,461,810 V369L probably benign Het
Ly6g5c A G 17: 35,111,807 M102V probably benign Het
Malrd1 A G 2: 15,695,270 S643G unknown Het
Mib2 T C 4: 155,654,810 N904S probably benign Het
Mug2 G A 6: 122,079,644 V1183I probably damaging Het
Nckap1l C T 15: 103,482,160 T786I probably damaging Het
Neb T C 2: 52,334,492 probably benign Het
Neu3 A G 7: 99,813,967 V183A probably benign Het
Nod1 A G 6: 54,944,307 L342P probably damaging Het
Nop58 T C 1: 59,700,938 V163A probably damaging Het
Npr3 C T 15: 11,895,682 G293R probably null Het
Obscn T A 11: 59,061,427 K3939* probably null Het
Olfr1279 T A 2: 111,306,448 M81K probably damaging Het
Olfr1426 G A 19: 12,088,006 A262V probably benign Het
Olfr180 A T 16: 58,916,047 M198K possibly damaging Het
Olfr502 A G 7: 108,523,851 I33T probably benign Het
Olfr875 T C 9: 37,772,821 L54P probably damaging Het
P2ry6 A G 7: 100,938,577 Y192H probably damaging Het
Paxbp1 A G 16: 91,022,667 probably null Het
Pign G A 1: 105,649,367 T197I probably benign Het
Pirb A T 7: 3,713,818 probably null Het
Pkdrej C A 15: 85,818,921 R938L possibly damaging Het
Psg21 A G 7: 18,647,203 *472R probably null Het
Rabgap1l A T 1: 160,682,084 S474R probably benign Het
Rrn3 C T 16: 13,810,511 Q519* probably null Het
Seh1l A T 18: 67,775,118 K37* probably null Het
Shprh A G 10: 11,164,705 S641G probably benign Het
Slc4a1 T G 11: 102,352,577 S743R probably damaging Het
Snx13 C T 12: 35,124,535 R688* probably null Het
Tlr11 C T 14: 50,361,729 Q391* probably null Het
Tmbim4 A G 10: 120,217,566 H90R probably benign Het
Trav8d-1 T C 14: 52,778,869 S71P possibly damaging Het
Trbv5 G A 6: 41,062,683 R74Q probably benign Het
Tril A G 6: 53,818,936 S434P probably benign Het
Uhmk1 A G 1: 170,200,001 Y376H probably damaging Het
Uty A G Y: 1,170,914 C317R probably damaging Het
Vmp1 C T 11: 86,585,399 C377Y probably benign Het
Vwa8 A C 14: 78,982,234 probably null Het
Wdr41 T C 13: 95,005,767 S150P probably damaging Het
Zfp617 T A 8: 71,932,020 Y65N probably benign Het
Zfp800 A C 6: 28,244,090 V292G probably damaging Het
Other mutations in B3galnt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00227:B3galnt2 APN 13 13987431 missense probably benign 0.15
IGL01149:B3galnt2 APN 13 13980685 missense probably benign 0.07
IGL01814:B3galnt2 APN 13 13987353 missense probably damaging 1.00
IGL02383:B3galnt2 APN 13 13997033 makesense probably null
R0106:B3galnt2 UTSW 13 13995793 missense probably benign
R0349:B3galnt2 UTSW 13 13991474 missense probably benign
R0676:B3galnt2 UTSW 13 13995793 missense probably benign
R1522:B3galnt2 UTSW 13 13970769 missense probably damaging 1.00
R1830:B3galnt2 UTSW 13 13991534 nonsense probably null
R2035:B3galnt2 UTSW 13 13966324 missense probably benign 0.10
R3686:B3galnt2 UTSW 13 13975635 critical splice donor site probably null
R3954:B3galnt2 UTSW 13 13966454 missense probably benign 0.04
R5369:B3galnt2 UTSW 13 13994425 splice site probably null
R5435:B3galnt2 UTSW 13 13996990 missense probably benign 0.01
R5564:B3galnt2 UTSW 13 13995229 missense probably damaging 1.00
R5628:B3galnt2 UTSW 13 13995152 splice site probably null
R6118:B3galnt2 UTSW 13 13991509 missense probably damaging 0.96
R6396:B3galnt2 UTSW 13 13995748 missense probably damaging 1.00
R6529:B3galnt2 UTSW 13 13995792 missense probably benign 0.00
R6656:B3galnt2 UTSW 13 13975576 missense probably benign 0.00
R7345:B3galnt2 UTSW 13 13980480 splice site probably null
R7439:B3galnt2 UTSW 13 13994485 missense probably benign 0.34
R7441:B3galnt2 UTSW 13 13994485 missense probably benign 0.34
R7849:B3galnt2 UTSW 13 13994492 missense probably benign 0.15
R8135:B3galnt2 UTSW 13 13970869 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- ATCCCAAGTAGGCTTCCCTG -3'
(R):5'- TGAAATCTCAGTGGCTTGATGATG -3'

Sequencing Primer
(F):5'- CAAGTAGGCTTCCCTGAGCTGTAG -3'
(R):5'- GATGATGTTTCATAAACCTACCCC -3'
Posted On2019-10-24