Incidental Mutation 'R7582:Olfr180'
ID586831
Institutional Source Beutler Lab
Gene Symbol Olfr180
Ensembl Gene ENSMUSG00000090629
Gene Nameolfactory receptor 180
SynonymsMOR184-11P, GA_x54KRFPKG5P-55134972-55134019, Olfr1563-ps1, MOR184-9, MOR184-11P
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R7582 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location58914285-58929392 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 58916047 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 198 (M198K)
Ref Sequence ENSEMBL: ENSMUSP00000128358 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000171656] [ENSMUST00000205883] [ENSMUST00000206168]
Predicted Effect possibly damaging
Transcript: ENSMUST00000171656
AA Change: M198K

PolyPhen 2 Score 0.476 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000128358
Gene: ENSMUSG00000090629
AA Change: M198K

DomainStartEndE-ValueType
Pfam:7tm_4 31 305 1.4e-51 PFAM
Pfam:7tm_1 41 313 1e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000205883
Predicted Effect possibly damaging
Transcript: ENSMUST00000206168
AA Change: M198K

PolyPhen 2 Score 0.645 (Sensitivity: 0.87; Specificity: 0.91)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgb A G 10: 10,390,821 V1007A probably damaging Het
Adgrl3 T C 5: 81,693,676 V800A probably damaging Het
Ankfn1 T A 11: 89,526,619 M56L probably benign Het
Arfgap3 A C 15: 83,303,101 V72G possibly damaging Het
B3galnt2 C T 13: 13,991,401 R294W probably damaging Het
Cadm1 G T 9: 47,797,442 D157Y probably damaging Het
Ccdc81 A T 7: 89,876,145 Y474N probably damaging Het
Cdkl4 T A 17: 80,533,835 K297I probably benign Het
Cep128 G A 12: 91,347,566 T146M probably damaging Het
Cfap161 T C 7: 83,777,082 N236S possibly damaging Het
Chil3 A T 3: 106,164,256 W31R probably damaging Het
Cmtm2b C T 8: 104,322,721 S86F probably damaging Het
Cntnap5a G A 1: 116,446,632 G958D probably damaging Het
Col6a5 A G 9: 105,945,426 L244P unknown Het
Crat C T 2: 30,404,565 R497Q probably benign Het
Cul9 A G 17: 46,510,979 Y1857H probably damaging Het
Dst A G 1: 34,169,883 Q1154R probably damaging Het
Fgg G A 3: 83,014,138 G376D probably damaging Het
Fmn2 T C 1: 174,698,790 S1392P probably damaging Het
Focad T C 4: 88,229,378 V418A probably benign Het
Foxf1 A T 8: 121,084,691 H98L possibly damaging Het
Frmd4a C CA 2: 4,594,597 probably null Het
Fry C A 5: 150,496,382 T639K Het
Fryl A G 5: 73,022,500 probably null Het
Gatsl3 T C 11: 4,220,457 V151A probably benign Het
Gdpd4 A G 7: 97,957,805 probably null Het
Gpt2 A G 8: 85,519,516 K368R probably damaging Het
Hc A T 2: 34,991,266 V1447E possibly damaging Het
Kmt5a A G 5: 124,459,919 T280A probably benign Het
Lrrc4b G T 7: 44,461,810 V369L probably benign Het
Ly6g5c A G 17: 35,111,807 M102V probably benign Het
Malrd1 A G 2: 15,695,270 S643G unknown Het
Mib2 T C 4: 155,654,810 N904S probably benign Het
Mug2 G A 6: 122,079,644 V1183I probably damaging Het
Nckap1l C T 15: 103,482,160 T786I probably damaging Het
Neb T C 2: 52,334,492 probably benign Het
Neu3 A G 7: 99,813,967 V183A probably benign Het
Nod1 A G 6: 54,944,307 L342P probably damaging Het
Nop58 T C 1: 59,700,938 V163A probably damaging Het
Npr3 C T 15: 11,895,682 G293R probably null Het
Obscn T A 11: 59,061,427 K3939* probably null Het
Olfr1279 T A 2: 111,306,448 M81K probably damaging Het
Olfr1426 G A 19: 12,088,006 A262V probably benign Het
Olfr502 A G 7: 108,523,851 I33T probably benign Het
Olfr875 T C 9: 37,772,821 L54P probably damaging Het
P2ry6 A G 7: 100,938,577 Y192H probably damaging Het
Paxbp1 A G 16: 91,022,667 probably null Het
Pign G A 1: 105,649,367 T197I probably benign Het
Pirb A T 7: 3,713,818 probably null Het
Pkdrej C A 15: 85,818,921 R938L possibly damaging Het
Psg21 A G 7: 18,647,203 *472R probably null Het
Rabgap1l A T 1: 160,682,084 S474R probably benign Het
Rrn3 C T 16: 13,810,511 Q519* probably null Het
Seh1l A T 18: 67,775,118 K37* probably null Het
Shprh A G 10: 11,164,705 S641G probably benign Het
Slc4a1 T G 11: 102,352,577 S743R probably damaging Het
Snx13 C T 12: 35,124,535 R688* probably null Het
Tlr11 C T 14: 50,361,729 Q391* probably null Het
Tmbim4 A G 10: 120,217,566 H90R probably benign Het
Trav8d-1 T C 14: 52,778,869 S71P possibly damaging Het
Trbv5 G A 6: 41,062,683 R74Q probably benign Het
Tril A G 6: 53,818,936 S434P probably benign Het
Uhmk1 A G 1: 170,200,001 Y376H probably damaging Het
Uty A G Y: 1,170,914 C317R probably damaging Het
Vmp1 C T 11: 86,585,399 C377Y probably benign Het
Vwa8 A C 14: 78,982,234 probably null Het
Wdr41 T C 13: 95,005,767 S150P probably damaging Het
Zfp617 T A 8: 71,932,020 Y65N probably benign Het
Zfp800 A C 6: 28,244,090 V292G probably damaging Het
Other mutations in Olfr180
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Olfr180 APN 16 58915850 missense probably benign 0.01
IGL01759:Olfr180 APN 16 58915928 missense probably damaging 0.99
IGL02499:Olfr180 APN 16 58916251 missense probably damaging 1.00
IGL02890:Olfr180 APN 16 58916374 missense probably benign 0.03
R1123:Olfr180 UTSW 16 58916334 nonsense probably null
R1292:Olfr180 UTSW 16 58915771 missense probably damaging 1.00
R2983:Olfr180 UTSW 16 58916567 missense probably benign 0.00
R3894:Olfr180 UTSW 16 58916339 missense probably benign 0.28
R4176:Olfr180 UTSW 16 58916584 missense probably benign 0.01
R4666:Olfr180 UTSW 16 58916584 missense probably benign 0.01
R5058:Olfr180 UTSW 16 58916072 missense probably benign 0.00
R5375:Olfr180 UTSW 16 58915885 missense possibly damaging 0.83
R5998:Olfr180 UTSW 16 58916630 missense probably benign
R6225:Olfr180 UTSW 16 58916182 missense probably benign 0.32
R6315:Olfr180 UTSW 16 58916246 missense probably damaging 1.00
R6380:Olfr180 UTSW 16 58916264 missense probably damaging 1.00
R6866:Olfr180 UTSW 16 58915988 missense probably damaging 1.00
R7513:Olfr180 UTSW 16 58915932 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCCACTGGTATGTCTTTATTACC -3'
(R):5'- GCATGATGTCCAAGAAACTCTC -3'

Sequencing Primer
(F):5'- TGTCTTTATTACCTTCGTCAAATGG -3'
(R):5'- CTCTCCATTCAGATGAGTATAGGCAC -3'
Posted On2019-10-24