Incidental Mutation 'R7582:Cul9'
ID586834
Institutional Source Beutler Lab
Gene Symbol Cul9
Ensembl Gene ENSMUSG00000040327
Gene Namecullin 9
Synonyms1810035I07Rik, Parc
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.259) question?
Stock #R7582 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location46500572-46546388 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 46510979 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 1857 (Y1857H)
Ref Sequence ENSEMBL: ENSMUSP00000138418 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066026] [ENSMUST00000182485]
Predicted Effect probably damaging
Transcript: ENSMUST00000066026
AA Change: Y1857H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000067736
Gene: ENSMUSG00000040327
AA Change: Y1857H

DomainStartEndE-ValueType
low complexity region 46 61 N/A INTRINSIC
low complexity region 119 131 N/A INTRINSIC
low complexity region 345 357 N/A INTRINSIC
Pfam:Cul7 367 441 1e-35 PFAM
low complexity region 447 460 N/A INTRINSIC
low complexity region 525 540 N/A INTRINSIC
low complexity region 845 860 N/A INTRINSIC
low complexity region 873 880 N/A INTRINSIC
APC10 1166 1325 1.97e-56 SMART
low complexity region 1437 1450 N/A INTRINSIC
low complexity region 1563 1578 N/A INTRINSIC
low complexity region 1646 1671 N/A INTRINSIC
Cullin_Nedd8 1867 1950 7.55e-6 SMART
Blast:RING 2074 2122 2e-13 BLAST
IBR 2144 2207 8.99e-14 SMART
IBR 2228 2283 4.66e-2 SMART
low complexity region 2503 2520 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000182485
AA Change: Y1857H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000138418
Gene: ENSMUSG00000040327
AA Change: Y1857H

DomainStartEndE-ValueType
low complexity region 46 61 N/A INTRINSIC
low complexity region 119 131 N/A INTRINSIC
low complexity region 345 357 N/A INTRINSIC
Pfam:Cul7 367 442 1.4e-33 PFAM
low complexity region 447 460 N/A INTRINSIC
low complexity region 525 540 N/A INTRINSIC
low complexity region 845 860 N/A INTRINSIC
low complexity region 873 880 N/A INTRINSIC
APC10 1166 1325 1.97e-56 SMART
low complexity region 1437 1450 N/A INTRINSIC
low complexity region 1563 1578 N/A INTRINSIC
low complexity region 1646 1671 N/A INTRINSIC
Cullin_Nedd8 1867 1950 7.55e-6 SMART
Blast:RING 2074 2122 3e-13 BLAST
IBR 2144 2207 8.99e-14 SMART
IBR 2228 2283 4.66e-2 SMART
coiled coil region 2461 2497 N/A INTRINSIC
low complexity region 2513 2530 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased body weight, increased incidence of tumors, and decreased cellular sensitivity to radiation-induced apoptosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgb A G 10: 10,390,821 V1007A probably damaging Het
Adgrl3 T C 5: 81,693,676 V800A probably damaging Het
Ankfn1 T A 11: 89,526,619 M56L probably benign Het
Arfgap3 A C 15: 83,303,101 V72G possibly damaging Het
B3galnt2 C T 13: 13,991,401 R294W probably damaging Het
Cadm1 G T 9: 47,797,442 D157Y probably damaging Het
Ccdc81 A T 7: 89,876,145 Y474N probably damaging Het
Cdkl4 T A 17: 80,533,835 K297I probably benign Het
Cep128 G A 12: 91,347,566 T146M probably damaging Het
Cfap161 T C 7: 83,777,082 N236S possibly damaging Het
Chil3 A T 3: 106,164,256 W31R probably damaging Het
Cmtm2b C T 8: 104,322,721 S86F probably damaging Het
Cntnap5a G A 1: 116,446,632 G958D probably damaging Het
Col6a5 A G 9: 105,945,426 L244P unknown Het
Crat C T 2: 30,404,565 R497Q probably benign Het
Dst A G 1: 34,169,883 Q1154R probably damaging Het
Fgg G A 3: 83,014,138 G376D probably damaging Het
Fmn2 T C 1: 174,698,790 S1392P probably damaging Het
Focad T C 4: 88,229,378 V418A probably benign Het
Foxf1 A T 8: 121,084,691 H98L possibly damaging Het
Frmd4a C CA 2: 4,594,597 probably null Het
Fry C A 5: 150,496,382 T639K Het
Fryl A G 5: 73,022,500 probably null Het
Gatsl3 T C 11: 4,220,457 V151A probably benign Het
Gdpd4 A G 7: 97,957,805 probably null Het
Gpt2 A G 8: 85,519,516 K368R probably damaging Het
Hc A T 2: 34,991,266 V1447E possibly damaging Het
Kmt5a A G 5: 124,459,919 T280A probably benign Het
Lrrc4b G T 7: 44,461,810 V369L probably benign Het
Ly6g5c A G 17: 35,111,807 M102V probably benign Het
Malrd1 A G 2: 15,695,270 S643G unknown Het
Mib2 T C 4: 155,654,810 N904S probably benign Het
Mug2 G A 6: 122,079,644 V1183I probably damaging Het
Nckap1l C T 15: 103,482,160 T786I probably damaging Het
Neb T C 2: 52,334,492 probably benign Het
Neu3 A G 7: 99,813,967 V183A probably benign Het
Nod1 A G 6: 54,944,307 L342P probably damaging Het
Nop58 T C 1: 59,700,938 V163A probably damaging Het
Npr3 C T 15: 11,895,682 G293R probably null Het
Obscn T A 11: 59,061,427 K3939* probably null Het
Olfr1279 T A 2: 111,306,448 M81K probably damaging Het
Olfr1426 G A 19: 12,088,006 A262V probably benign Het
Olfr180 A T 16: 58,916,047 M198K possibly damaging Het
Olfr502 A G 7: 108,523,851 I33T probably benign Het
Olfr875 T C 9: 37,772,821 L54P probably damaging Het
P2ry6 A G 7: 100,938,577 Y192H probably damaging Het
Paxbp1 A G 16: 91,022,667 probably null Het
Pign G A 1: 105,649,367 T197I probably benign Het
Pirb A T 7: 3,713,818 probably null Het
Pkdrej C A 15: 85,818,921 R938L possibly damaging Het
Psg21 A G 7: 18,647,203 *472R probably null Het
Rabgap1l A T 1: 160,682,084 S474R probably benign Het
Rrn3 C T 16: 13,810,511 Q519* probably null Het
Seh1l A T 18: 67,775,118 K37* probably null Het
Shprh A G 10: 11,164,705 S641G probably benign Het
Slc4a1 T G 11: 102,352,577 S743R probably damaging Het
Snx13 C T 12: 35,124,535 R688* probably null Het
Tlr11 C T 14: 50,361,729 Q391* probably null Het
Tmbim4 A G 10: 120,217,566 H90R probably benign Het
Trav8d-1 T C 14: 52,778,869 S71P possibly damaging Het
Trbv5 G A 6: 41,062,683 R74Q probably benign Het
Tril A G 6: 53,818,936 S434P probably benign Het
Uhmk1 A G 1: 170,200,001 Y376H probably damaging Het
Uty A G Y: 1,170,914 C317R probably damaging Het
Vmp1 C T 11: 86,585,399 C377Y probably benign Het
Vwa8 A C 14: 78,982,234 probably null Het
Wdr41 T C 13: 95,005,767 S150P probably damaging Het
Zfp617 T A 8: 71,932,020 Y65N probably benign Het
Zfp800 A C 6: 28,244,090 V292G probably damaging Het
Other mutations in Cul9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Cul9 APN 17 46525709 missense probably damaging 1.00
IGL00330:Cul9 APN 17 46510841 splice site probably benign
IGL00726:Cul9 APN 17 46528096 missense probably damaging 1.00
IGL01020:Cul9 APN 17 46539023 missense probably damaging 1.00
IGL01358:Cul9 APN 17 46538314 missense probably damaging 1.00
IGL01410:Cul9 APN 17 46528646 missense probably damaging 0.99
IGL01781:Cul9 APN 17 46539304 missense probably benign
IGL01873:Cul9 APN 17 46502452 missense probably damaging 0.99
IGL02117:Cul9 APN 17 46540375 missense probably benign 0.00
IGL02300:Cul9 APN 17 46521032 splice site probably benign
IGL02426:Cul9 APN 17 46523258 missense possibly damaging 0.95
IGL02427:Cul9 APN 17 46502632 missense possibly damaging 0.69
IGL02496:Cul9 APN 17 46540376 missense possibly damaging 0.72
IGL03008:Cul9 APN 17 46502697 splice site probably benign
IGL03059:Cul9 APN 17 46538987 missense probably damaging 0.98
IGL03302:Cul9 APN 17 46526640 missense probably damaging 0.98
bottlenose UTSW 17 46500844 missense possibly damaging 0.79
flipper UTSW 17 46525892 missense probably benign 0.05
orca UTSW 17 46525135 missense probably damaging 1.00
FR4340:Cul9 UTSW 17 46500853 small insertion probably benign
FR4449:Cul9 UTSW 17 46500856 small insertion probably benign
FR4737:Cul9 UTSW 17 46500846 small insertion probably benign
FR4737:Cul9 UTSW 17 46500858 small insertion probably benign
FR4976:Cul9 UTSW 17 46500848 small insertion probably benign
FR4976:Cul9 UTSW 17 46500850 small insertion probably benign
FR4976:Cul9 UTSW 17 46500853 small insertion probably benign
FR4976:Cul9 UTSW 17 46500856 small insertion probably benign
R0012:Cul9 UTSW 17 46538510 missense probably benign 0.26
R0079:Cul9 UTSW 17 46537663 nonsense probably null
R0143:Cul9 UTSW 17 46526410 missense possibly damaging 0.65
R0390:Cul9 UTSW 17 46528589 missense probably benign 0.34
R0401:Cul9 UTSW 17 46541704 missense probably damaging 1.00
R0529:Cul9 UTSW 17 46520468 splice site probably benign
R0815:Cul9 UTSW 17 46537822 splice site probably null
R0863:Cul9 UTSW 17 46537822 splice site probably null
R0972:Cul9 UTSW 17 46522175 missense probably damaging 1.00
R1173:Cul9 UTSW 17 46522175 missense probably damaging 1.00
R1216:Cul9 UTSW 17 46522175 missense probably damaging 1.00
R1217:Cul9 UTSW 17 46522175 missense probably damaging 1.00
R1261:Cul9 UTSW 17 46525782 missense probably damaging 1.00
R1278:Cul9 UTSW 17 46500849 small deletion probably benign
R1281:Cul9 UTSW 17 46511534 missense probably damaging 1.00
R1349:Cul9 UTSW 17 46522175 missense probably damaging 1.00
R1372:Cul9 UTSW 17 46522175 missense probably damaging 1.00
R1403:Cul9 UTSW 17 46522175 missense probably damaging 1.00
R1403:Cul9 UTSW 17 46522175 missense probably damaging 1.00
R1405:Cul9 UTSW 17 46522175 missense probably damaging 1.00
R1405:Cul9 UTSW 17 46522175 missense probably damaging 1.00
R1467:Cul9 UTSW 17 46525373 missense probably damaging 1.00
R1467:Cul9 UTSW 17 46525373 missense probably damaging 1.00
R1482:Cul9 UTSW 17 46508547 missense probably damaging 0.99
R1491:Cul9 UTSW 17 46538564 nonsense probably null
R1618:Cul9 UTSW 17 46525892 missense probably benign 0.05
R1641:Cul9 UTSW 17 46543560 missense possibly damaging 0.96
R1679:Cul9 UTSW 17 46521156 missense possibly damaging 0.90
R1771:Cul9 UTSW 17 46537812 missense probably benign 0.41
R1803:Cul9 UTSW 17 46503097 missense probably damaging 1.00
R2020:Cul9 UTSW 17 46522175 missense probably damaging 1.00
R2046:Cul9 UTSW 17 46543733 missense probably damaging 1.00
R2056:Cul9 UTSW 17 46543372 missense probably benign
R2088:Cul9 UTSW 17 46526649 missense probably damaging 1.00
R2415:Cul9 UTSW 17 46543438 missense probably benign
R2925:Cul9 UTSW 17 46510981 missense probably benign 0.08
R2964:Cul9 UTSW 17 46502228 missense probably damaging 0.96
R2965:Cul9 UTSW 17 46502228 missense probably damaging 0.96
R3690:Cul9 UTSW 17 46504031 splice site probably null
R3847:Cul9 UTSW 17 46525135 missense probably damaging 1.00
R4437:Cul9 UTSW 17 46502159 missense probably damaging 1.00
R4470:Cul9 UTSW 17 46538336 missense probably benign 0.00
R4540:Cul9 UTSW 17 46503089 missense probably null 0.98
R4555:Cul9 UTSW 17 46501829 missense possibly damaging 0.82
R4604:Cul9 UTSW 17 46530146 missense probably damaging 0.99
R4646:Cul9 UTSW 17 46539017 nonsense probably null
R4799:Cul9 UTSW 17 46500844 missense possibly damaging 0.79
R4822:Cul9 UTSW 17 46530051 missense probably benign 0.01
R4964:Cul9 UTSW 17 46538525 missense probably damaging 1.00
R4965:Cul9 UTSW 17 46538525 missense probably damaging 1.00
R5027:Cul9 UTSW 17 46500782 missense probably damaging 0.99
R5185:Cul9 UTSW 17 46525832 missense possibly damaging 0.95
R5237:Cul9 UTSW 17 46543467 missense probably benign 0.00
R5278:Cul9 UTSW 17 46510873 missense probably damaging 1.00
R5361:Cul9 UTSW 17 46500849 small deletion probably benign
R5455:Cul9 UTSW 17 46510846 splice site probably null
R5592:Cul9 UTSW 17 46520591 missense probably benign 0.00
R5597:Cul9 UTSW 17 46502665 missense possibly damaging 0.56
R5613:Cul9 UTSW 17 46503844 missense probably damaging 1.00
R6122:Cul9 UTSW 17 46521928 missense possibly damaging 0.72
R6135:Cul9 UTSW 17 46521453 missense probably benign
R6352:Cul9 UTSW 17 46511315 missense probably benign 0.00
R6376:Cul9 UTSW 17 46508563 missense probably damaging 1.00
R6868:Cul9 UTSW 17 46522183 missense possibly damaging 0.73
R6898:Cul9 UTSW 17 46511026 missense possibly damaging 0.87
R7090:Cul9 UTSW 17 46500839 missense probably damaging 0.96
R7193:Cul9 UTSW 17 46538497 missense probably damaging 0.98
R7221:Cul9 UTSW 17 46528565 missense probably damaging 0.99
R7291:Cul9 UTSW 17 46540433 missense probably benign 0.00
R7320:Cul9 UTSW 17 46510909 missense possibly damaging 0.80
R7348:Cul9 UTSW 17 46510993 missense possibly damaging 0.89
R7463:Cul9 UTSW 17 46520476 splice site probably null
R7480:Cul9 UTSW 17 46537812 missense probably benign 0.41
R7573:Cul9 UTSW 17 46519910 missense probably benign
R7605:Cul9 UTSW 17 46541732 missense probably damaging 0.99
R7684:Cul9 UTSW 17 46509889 missense probably damaging 1.00
R7830:Cul9 UTSW 17 46540311 missense probably benign 0.37
R7917:Cul9 UTSW 17 46525704 splice site probably null
RF011:Cul9 UTSW 17 46500848 small insertion probably benign
RF016:Cul9 UTSW 17 46500863 nonsense probably null
RF026:Cul9 UTSW 17 46500869 nonsense probably null
RF027:Cul9 UTSW 17 46500848 small insertion probably benign
RF030:Cul9 UTSW 17 46500869 small insertion probably benign
RF033:Cul9 UTSW 17 46500854 small insertion probably benign
RF039:Cul9 UTSW 17 46500854 small insertion probably benign
RF041:Cul9 UTSW 17 46500854 nonsense probably null
RF042:Cul9 UTSW 17 46540615 frame shift probably null
RF057:Cul9 UTSW 17 46500863 nonsense probably null
Z1176:Cul9 UTSW 17 46520576 nonsense probably null
Z1176:Cul9 UTSW 17 46520585 nonsense probably null
Z1177:Cul9 UTSW 17 46537797 missense not run
Predicted Primers PCR Primer
(F):5'- TAACTTCTCCTGAGATGACCCACG -3'
(R):5'- TCTCTGCTGAACCTCTGTGG -3'

Sequencing Primer
(F):5'- AGATGACCCACGCGTGACTC -3'
(R):5'- TGGTATGCTGGGAGGCCC -3'
Posted On2019-10-24