Incidental Mutation 'R0621:Ankrd40'
ID58684
Institutional Source Beutler Lab
Gene Symbol Ankrd40
Ensembl Gene ENSMUSG00000020864
Gene Nameankyrin repeat domain 40
Synonyms1110011C06Rik, 5530600A18Rik, Gcap15
MMRRC Submission 038810-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.106) question?
Stock #R0621 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location94328001-94341841 bp(+) (GRCm38)
Type of Mutationsplice site (98 bp from exon)
DNA Base Change (assembly) A to G at 94339607 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000021227 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021227] [ENSMUST00000021231] [ENSMUST00000051221] [ENSMUST00000107818] [ENSMUST00000178136]
Predicted Effect probably null
Transcript: ENSMUST00000021227
SMART Domains Protein: ENSMUSP00000021227
Gene: ENSMUSG00000020864

DomainStartEndE-ValueType
ANK 9 38 7.29e2 SMART
ANK 43 72 3.57e-6 SMART
low complexity region 144 168 N/A INTRINSIC
low complexity region 234 251 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000021231
SMART Domains Protein: ENSMUSP00000021231
Gene: ENSMUSG00000020865

DomainStartEndE-ValueType
transmembrane domain 35 57 N/A INTRINSIC
transmembrane domain 64 86 N/A INTRINSIC
transmembrane domain 101 123 N/A INTRINSIC
transmembrane domain 130 152 N/A INTRINSIC
transmembrane domain 172 190 N/A INTRINSIC
Pfam:ABC_membrane 310 581 4.4e-43 PFAM
AAA 652 827 2.77e-10 SMART
Pfam:ABC_membrane 963 1235 3.2e-46 PFAM
AAA 1310 1495 2.66e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000051221
SMART Domains Protein: ENSMUSP00000061637
Gene: ENSMUSG00000020864

DomainStartEndE-ValueType
ANK 9 38 7.29e2 SMART
ANK 43 72 3.57e-6 SMART
low complexity region 144 168 N/A INTRINSIC
low complexity region 234 251 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107818
AA Change: I334V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000103448
Gene: ENSMUSG00000020864
AA Change: I334V

DomainStartEndE-ValueType
ANK 9 38 7.29e2 SMART
ANK 43 72 3.57e-6 SMART
low complexity region 144 168 N/A INTRINSIC
low complexity region 234 251 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124087
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140985
Predicted Effect probably benign
Transcript: ENSMUST00000178136
SMART Domains Protein: ENSMUSP00000136343
Gene: ENSMUSG00000020865

DomainStartEndE-ValueType
transmembrane domain 35 57 N/A INTRINSIC
transmembrane domain 64 86 N/A INTRINSIC
transmembrane domain 101 123 N/A INTRINSIC
transmembrane domain 130 152 N/A INTRINSIC
transmembrane domain 172 190 N/A INTRINSIC
Pfam:ABC_membrane 310 581 4.8e-34 PFAM
AAA 652 827 2.77e-10 SMART
coiled coil region 854 883 N/A INTRINSIC
Pfam:ABC_membrane 967 1236 8.6e-48 PFAM
AAA 1311 1496 2.66e-12 SMART
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 99.0%
  • 10x: 97.8%
  • 20x: 96.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abr T C 11: 76,509,072 D33G probably damaging Het
Adgre1 T A 17: 57,441,359 S520T probably damaging Het
Aph1b A T 9: 66,779,334 I177K possibly damaging Het
Armc3 A T 2: 19,295,393 N579I probably damaging Het
Atxn7l1 T C 12: 33,326,100 V131A probably benign Het
C130073F10Rik A G 4: 101,890,795 Y61H probably damaging Het
C1s2 A T 6: 124,631,112 L214Q probably damaging Het
Caprin2 A T 6: 148,858,678 S425T possibly damaging Het
Cdc42ep4 G A 11: 113,728,696 R290C probably damaging Het
Cenpf T C 1: 189,672,628 T352A probably benign Het
Col6a4 A T 9: 106,066,791 F1161L probably damaging Het
Dctn2 T C 10: 127,277,940 probably null Het
Ddx24 T C 12: 103,425,558 probably benign Het
Dsg1c C A 18: 20,279,695 A591D possibly damaging Het
Efnb3 T C 11: 69,555,972 D304G probably damaging Het
Erbb3 T C 10: 128,586,225 Y50C probably benign Het
Eya3 T G 4: 132,694,802 D275E probably benign Het
Fam81a G T 9: 70,093,647 Q272K probably benign Het
Foxf1 T C 8: 121,085,180 V261A probably damaging Het
Gm9637 G A 14: 19,402,011 noncoding transcript Het
Gnb4 C T 3: 32,591,207 V112I probably benign Het
Gtf2h2 A T 13: 100,488,925 L61Q probably damaging Het
Hey2 T A 10: 30,834,386 I124F probably benign Het
Hoxb3 A T 11: 96,345,963 Y289F probably damaging Het
Kctd3 C T 1: 188,981,341 R399Q probably damaging Het
Kif26b C G 1: 178,915,653 P1105A probably benign Het
Klhl30 C T 1: 91,357,863 T369M probably damaging Het
Lipo2 C T 19: 33,730,939 G225D probably damaging Het
Macf1 T C 4: 123,380,534 K6350E probably damaging Het
Myh13 A C 11: 67,341,232 N446T probably damaging Het
Nos1ap T C 1: 170,318,581 D468G probably damaging Het
Olfr1250 C A 2: 89,657,115 E109* probably null Het
Olfr418 C T 1: 173,270,675 P167S possibly damaging Het
Olfr746 G A 14: 50,653,962 G242R possibly damaging Het
Pde3a T C 6: 141,249,999 L137P probably damaging Het
Ppm1f G A 16: 16,915,308 R233Q probably benign Het
Rtf2 C A 2: 172,466,296 A205E possibly damaging Het
Sh2d5 T C 4: 138,258,318 F359S probably benign Het
Siglec1 G A 2: 131,074,268 T1254M probably benign Het
Slc39a11 G A 11: 113,464,079 P108L probably benign Het
Slc6a5 G A 7: 49,917,365 probably null Het
Snph C T 2: 151,593,722 V360M probably damaging Het
Snx29 A G 16: 11,405,787 probably null Het
Sos1 A G 17: 80,451,979 probably null Het
Spata5 C T 3: 37,432,029 T300I probably benign Het
St8sia6 T A 2: 13,657,282 N246I probably damaging Het
Thy1 T A 9: 44,046,733 F53I probably damaging Het
Tle3 T A 9: 61,410,105 Y421* probably null Het
Ttc21b C T 2: 66,226,011 R677Q probably benign Het
Vmn2r107 A T 17: 20,374,990 I602F probably benign Het
Wdr17 C A 8: 54,643,191 G1016C probably benign Het
Wdr62 T C 7: 30,254,061 E182G possibly damaging Het
Zfp597 A G 16: 3,866,364 I176T probably benign Het
Other mutations in Ankrd40
AlleleSourceChrCoordTypePredicted EffectPPH Score
G1patch:Ankrd40 UTSW 11 94334815 missense probably benign 0.01
R2873:Ankrd40 UTSW 11 94333945 missense possibly damaging 0.62
R4817:Ankrd40 UTSW 11 94339633 missense probably benign 0.00
R4931:Ankrd40 UTSW 11 94334821 missense probably benign 0.41
R5026:Ankrd40 UTSW 11 94339724 unclassified probably benign
R5504:Ankrd40 UTSW 11 94328327 missense probably benign 0.31
R5891:Ankrd40 UTSW 11 94334863 missense probably damaging 1.00
R6089:Ankrd40 UTSW 11 94333925 missense probably damaging 1.00
R6725:Ankrd40 UTSW 11 94334815 missense probably benign 0.01
R7789:Ankrd40 UTSW 11 94334709 missense probably damaging 1.00
R8179:Ankrd40 UTSW 11 94334715 missense probably benign 0.00
R8376:Ankrd40 UTSW 11 94334836 missense probably damaging 1.00
R8378:Ankrd40 UTSW 11 94334836 missense probably damaging 1.00
R8419:Ankrd40 UTSW 11 94334836 missense probably damaging 1.00
R8421:Ankrd40 UTSW 11 94334836 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCATTCTCATCCTGCAACAGAGAC -3'
(R):5'- CCTTTGGCCCAGAGATGACACATAC -3'

Sequencing Primer
(F):5'- cctactgcaaagcctgaagac -3'
(R):5'- CTGTCACAGTACTCAGTGATGAAG -3'
Posted On2013-07-11