Incidental Mutation 'R7583:Ticrr'
ID 586880
Institutional Source Beutler Lab
Gene Symbol Ticrr
Ensembl Gene ENSMUSG00000046591
Gene Name TOPBP1-interacting checkpoint and replication regulator
Synonyms 5730590G19Rik
MMRRC Submission 045666-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.949) question?
Stock # R7583 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 79309944-79347896 bp(+) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) C to A at 79346487 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Stop codon at position 1882 (Y1882*)
Ref Sequence ENSEMBL: ENSMUSP00000041377 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035977] [ENSMUST00000059836] [ENSMUST00000178048] [ENSMUST00000183846] [ENSMUST00000184137] [ENSMUST00000206591] [ENSMUST00000206622]
AlphaFold Q8BQ33
Predicted Effect probably null
Transcript: ENSMUST00000035977
AA Change: Y1882*
SMART Domains Protein: ENSMUSP00000041377
Gene: ENSMUSG00000046591
AA Change: Y1882*

DomainStartEndE-ValueType
low complexity region 23 31 N/A INTRINSIC
Pfam:Treslin_N 211 1005 N/A PFAM
low complexity region 1186 1197 N/A INTRINSIC
low complexity region 1220 1235 N/A INTRINSIC
low complexity region 1339 1359 N/A INTRINSIC
low complexity region 1472 1480 N/A INTRINSIC
low complexity region 1496 1514 N/A INTRINSIC
low complexity region 1630 1643 N/A INTRINSIC
low complexity region 1694 1707 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000059836
SMART Domains Protein: ENSMUSP00000061806
Gene: ENSMUSG00000050382

DomainStartEndE-ValueType
KISc 13 357 2.88e-143 SMART
low complexity region 391 410 N/A INTRINSIC
Blast:KISc 413 481 1e-19 BLAST
Blast:KISc 482 518 3e-11 BLAST
low complexity region 523 540 N/A INTRINSIC
low complexity region 543 557 N/A INTRINSIC
low complexity region 621 636 N/A INTRINSIC
low complexity region 669 685 N/A INTRINSIC
Blast:KISc 780 879 2e-15 BLAST
low complexity region 927 944 N/A INTRINSIC
low complexity region 979 993 N/A INTRINSIC
low complexity region 1049 1061 N/A INTRINSIC
coiled coil region 1113 1139 N/A INTRINSIC
coiled coil region 1186 1205 N/A INTRINSIC
low complexity region 1293 1304 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000178048
SMART Domains Protein: ENSMUSP00000136993
Gene: ENSMUSG00000050382

DomainStartEndE-ValueType
KISc 13 357 2.88e-143 SMART
low complexity region 391 410 N/A INTRINSIC
Blast:KISc 413 481 1e-19 BLAST
Blast:KISc 482 518 3e-11 BLAST
low complexity region 523 540 N/A INTRINSIC
low complexity region 543 557 N/A INTRINSIC
low complexity region 621 636 N/A INTRINSIC
low complexity region 669 685 N/A INTRINSIC
Blast:KISc 780 879 2e-15 BLAST
low complexity region 908 918 N/A INTRINSIC
low complexity region 928 945 N/A INTRINSIC
low complexity region 980 994 N/A INTRINSIC
low complexity region 1050 1062 N/A INTRINSIC
coiled coil region 1114 1140 N/A INTRINSIC
coiled coil region 1187 1206 N/A INTRINSIC
low complexity region 1294 1305 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000183846
SMART Domains Protein: ENSMUSP00000139359
Gene: ENSMUSG00000050382

DomainStartEndE-ValueType
KISc 13 357 2.88e-143 SMART
low complexity region 391 410 N/A INTRINSIC
Blast:KISc 413 481 1e-19 BLAST
Blast:KISc 482 518 3e-11 BLAST
low complexity region 523 540 N/A INTRINSIC
low complexity region 543 557 N/A INTRINSIC
low complexity region 621 636 N/A INTRINSIC
low complexity region 669 685 N/A INTRINSIC
Blast:KISc 780 879 2e-15 BLAST
low complexity region 908 918 N/A INTRINSIC
low complexity region 928 945 N/A INTRINSIC
low complexity region 980 994 N/A INTRINSIC
low complexity region 1050 1062 N/A INTRINSIC
coiled coil region 1114 1140 N/A INTRINSIC
coiled coil region 1187 1206 N/A INTRINSIC
low complexity region 1294 1305 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000184137
SMART Domains Protein: ENSMUSP00000139224
Gene: ENSMUSG00000050382

DomainStartEndE-ValueType
KISc 13 357 2.88e-143 SMART
low complexity region 391 410 N/A INTRINSIC
Blast:KISc 413 481 1e-19 BLAST
Blast:KISc 482 518 3e-11 BLAST
low complexity region 523 540 N/A INTRINSIC
low complexity region 543 557 N/A INTRINSIC
low complexity region 621 636 N/A INTRINSIC
low complexity region 669 685 N/A INTRINSIC
Blast:KISc 780 879 2e-15 BLAST
low complexity region 927 944 N/A INTRINSIC
low complexity region 979 993 N/A INTRINSIC
low complexity region 1049 1061 N/A INTRINSIC
coiled coil region 1113 1139 N/A INTRINSIC
coiled coil region 1186 1205 N/A INTRINSIC
low complexity region 1293 1304 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000206591
Predicted Effect probably benign
Transcript: ENSMUST00000206622
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 99% (95/96)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Treslin is involved in the initiation of DNA replication (Kumagai et al., 2010 [PubMed 20116089]).[supplied by OMIM, Apr 2010]
PHENOTYPE: Mice homozygous for an ENU-induced allele are mostly hairless, with only a light patch of hair around the face and tail. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 98 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik A T 2: 68,569,670 (GRCm39) D462V probably damaging Het
Abcc1 T C 16: 14,221,902 (GRCm39) W222R probably damaging Het
Adamts13 A G 2: 26,863,965 (GRCm39) K48E probably benign Het
Adgrd1 A C 5: 129,256,652 (GRCm39) T674P probably benign Het
Agbl4 A T 4: 110,976,150 (GRCm39) Y169F possibly damaging Het
Ahnak T A 19: 8,983,457 (GRCm39) N1580K possibly damaging Het
Angptl8 A C 9: 21,747,210 (GRCm39) probably null Het
Ap3d1 G A 10: 80,545,292 (GRCm39) T1053I probably benign Het
Atad2 T C 15: 57,990,060 (GRCm39) T139A probably benign Het
Bdp1 T A 13: 100,186,320 (GRCm39) T1711S probably damaging Het
Bod1l T C 5: 41,991,133 (GRCm39) I141V probably damaging Het
Cavin2 A T 1: 51,328,777 (GRCm39) N78I possibly damaging Het
Ccnb1 T C 13: 100,916,262 (GRCm39) H406R probably benign Het
Cd200r4 A G 16: 44,653,784 (GRCm39) T194A probably damaging Het
Cdt1 G A 8: 123,296,995 (GRCm39) R263H probably damaging Het
Cep85l A T 10: 53,157,450 (GRCm39) I751N probably damaging Het
Clasp2 A G 9: 113,737,755 (GRCm39) D1043G probably benign Het
Cmip A T 8: 118,181,691 (GRCm39) N578I probably damaging Het
Col2a1 T G 15: 97,874,065 (GRCm39) K1440N unknown Het
Cpne2 A T 8: 95,282,209 (GRCm39) M252L probably benign Het
Crb2 A G 2: 37,680,607 (GRCm39) T512A probably benign Het
Csmd1 A G 8: 16,048,833 (GRCm39) Y2290H probably damaging Het
Ctnnd1 A T 2: 84,442,405 (GRCm39) D642E probably damaging Het
Ctns A G 11: 73,079,296 (GRCm39) S141P probably benign Het
Cwh43 A G 5: 73,591,632 (GRCm39) Q575R probably benign Het
Cyp2b19 C A 7: 26,458,489 (GRCm39) T68K probably damaging Het
Dcaf6 A G 1: 165,160,879 (GRCm39) S849P probably damaging Het
Dnm3 T A 1: 162,305,343 (GRCm39) Q17L possibly damaging Het
Enpp3 A T 10: 24,711,990 (GRCm39) M1K probably null Het
Fam124a T A 14: 62,844,008 (GRCm39) C505* probably null Het
Fhip2a T A 19: 57,367,034 (GRCm39) D192E probably benign Het
Fsip2 A G 2: 82,805,585 (GRCm39) I635V probably benign Het
Gm5878 A T 6: 85,095,682 (GRCm39) probably null Het
Gpld1 C A 13: 25,159,743 (GRCm39) A437D probably damaging Het
Grk5 G T 19: 61,071,642 (GRCm39) V401L possibly damaging Het
Gucy2g A T 19: 55,224,047 (GRCm39) L259Q probably damaging Het
Habp2 T A 19: 56,300,236 (GRCm39) D191E probably benign Het
Helz2 T A 2: 180,879,365 (GRCm39) H751L probably benign Het
Hgsnat A G 8: 26,461,592 (GRCm39) probably null Het
Hivep1 T A 13: 42,317,716 (GRCm39) V2064E probably damaging Het
Ikbke C T 1: 131,204,216 (GRCm39) A26T probably damaging Het
Ivd C A 2: 118,692,612 (GRCm39) D37E probably damaging Het
Kif26b G A 1: 178,358,010 (GRCm39) W40* probably null Het
Klrc2 A G 6: 129,636,274 (GRCm39) S114P probably damaging Het
Lama1 A T 17: 68,068,616 (GRCm39) T772S Het
Lamc1 T A 1: 153,118,978 (GRCm39) K880N possibly damaging Het
Lmf1 G A 17: 25,874,423 (GRCm39) D12N Het
Lpin2 G T 17: 71,538,391 (GRCm39) E384* probably null Het
Lrrc23 T C 6: 124,756,541 (GRCm39) probably benign Het
Lrrc31 T C 3: 30,745,248 (GRCm39) probably null Het
Luc7l2 A G 6: 38,528,820 (GRCm39) Q13R probably damaging Het
Ly6c1 G T 15: 74,920,346 (GRCm39) H5Q probably damaging Het
Lyst A T 13: 13,810,472 (GRCm39) H714L probably damaging Het
Man2a2 C T 7: 80,016,692 (GRCm39) R374H probably damaging Het
Mchr1 A T 15: 81,121,642 (GRCm39) T131S probably benign Het
Msto1 T C 3: 88,820,236 (GRCm39) probably null Het
Myh1 C T 11: 67,111,739 (GRCm39) T1698I probably benign Het
Ncapd3 G T 9: 26,983,144 (GRCm39) C964F probably damaging Het
Nefh T C 11: 4,891,089 (GRCm39) E510G probably damaging Het
Or10g3b T C 14: 52,587,360 (GRCm39) T48A possibly damaging Het
Or13a24 A G 7: 140,154,123 (GRCm39) E19G probably benign Het
Or1b1 A T 2: 36,995,539 (GRCm39) L41* probably null Het
Or1q1 A C 2: 36,887,092 (GRCm39) K90T probably damaging Het
Or4a73 A T 2: 89,421,095 (GRCm39) Y121* probably null Het
P4ha1 T A 10: 59,205,462 (GRCm39) S497R probably benign Het
Palb2 T C 7: 121,726,565 (GRCm39) D435G probably benign Het
Papola C T 12: 105,777,304 (GRCm39) P282L probably damaging Het
Pcdhgb1 A G 18: 37,815,377 (GRCm39) R623G probably damaging Het
Pcolce T G 5: 137,605,707 (GRCm39) K229Q probably benign Het
Pkhd1l1 T C 15: 44,431,760 (GRCm39) probably null Het
Ppp6r3 T A 19: 3,540,790 (GRCm39) T443S probably benign Het
Pramel58 A T 5: 94,830,753 (GRCm39) T84S possibly damaging Het
Psg20 T A 7: 18,416,408 (GRCm39) D236V probably damaging Het
Ptgr2 T G 12: 84,355,179 (GRCm39) S304R probably damaging Het
Ptpn22 A T 3: 103,809,430 (GRCm39) D681V probably benign Het
Rab3gap1 T C 1: 127,858,612 (GRCm39) S574P probably benign Het
Slc36a1 A G 11: 55,104,754 (GRCm39) probably null Het
Slc9a5 A G 8: 106,089,904 (GRCm39) S621G possibly damaging Het
Sntg1 A G 1: 8,515,249 (GRCm39) probably null Het
Snx17 A G 5: 31,353,877 (GRCm39) N222D possibly damaging Het
Spata19 G T 9: 27,311,729 (GRCm39) S116I possibly damaging Het
Spn G A 7: 126,736,234 (GRCm39) A91V probably damaging Het
Srrm3 T C 5: 135,881,135 (GRCm39) V145A probably benign Het
St7 A T 6: 17,942,753 (GRCm39) T575S possibly damaging Het
Taf2 A T 15: 54,928,072 (GRCm39) Y110* probably null Het
Tcf20 T C 15: 82,739,477 (GRCm39) E658G possibly damaging Het
Tdrd6 G T 17: 43,935,129 (GRCm39) A1973E probably benign Het
Tg T G 15: 66,636,267 (GRCm39) L2237W probably damaging Het
Trim45 T A 3: 100,832,339 (GRCm39) C191S probably damaging Het
Upf3a G A 8: 13,835,889 (GRCm39) probably null Het
Vmn2r42 A T 7: 8,197,740 (GRCm39) L293* probably null Het
Vmn2r62 T A 7: 42,437,466 (GRCm39) Q339H possibly damaging Het
Wdr24 A T 17: 26,044,804 (GRCm39) R220W probably null Het
Wdr5 T A 2: 27,408,787 (GRCm39) S22T probably benign Het
Zfp37 G A 4: 62,110,253 (GRCm39) probably benign Het
Zfp735 A T 11: 73,601,933 (GRCm39) L292F possibly damaging Het
Zfp985 T A 4: 147,667,946 (GRCm39) C271* probably null Het
Zranb1 G A 7: 132,585,625 (GRCm39) R691Q probably benign Het
Other mutations in Ticrr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Ticrr APN 7 79,327,031 (GRCm39) missense probably damaging 1.00
IGL00596:Ticrr APN 7 79,327,041 (GRCm39) missense probably damaging 1.00
IGL01327:Ticrr APN 7 79,344,209 (GRCm39) missense probably benign 0.00
IGL01525:Ticrr APN 7 79,332,197 (GRCm39) missense probably damaging 1.00
IGL01565:Ticrr APN 7 79,344,296 (GRCm39) missense probably benign
IGL01936:Ticrr APN 7 79,344,297 (GRCm39) missense probably benign 0.11
IGL02160:Ticrr APN 7 79,343,767 (GRCm39) missense probably benign 0.29
IGL02246:Ticrr APN 7 79,325,076 (GRCm39) missense probably damaging 1.00
IGL02487:Ticrr APN 7 79,332,769 (GRCm39) missense possibly damaging 0.86
IGL02593:Ticrr APN 7 79,345,214 (GRCm39) missense probably damaging 0.99
IGL02970:Ticrr APN 7 79,344,919 (GRCm39) missense probably benign 0.01
FR4304:Ticrr UTSW 7 79,344,059 (GRCm39) intron probably benign
PIT4305001:Ticrr UTSW 7 79,328,771 (GRCm39) missense possibly damaging 0.95
PIT4791001:Ticrr UTSW 7 79,319,386 (GRCm39) missense possibly damaging 0.92
R0016:Ticrr UTSW 7 79,343,540 (GRCm39) missense probably benign 0.01
R0062:Ticrr UTSW 7 79,317,654 (GRCm39) missense probably benign 0.01
R0062:Ticrr UTSW 7 79,317,654 (GRCm39) missense probably benign 0.01
R0067:Ticrr UTSW 7 79,327,158 (GRCm39) missense probably damaging 1.00
R0067:Ticrr UTSW 7 79,327,158 (GRCm39) missense probably damaging 1.00
R0362:Ticrr UTSW 7 79,327,088 (GRCm39) missense probably damaging 1.00
R0482:Ticrr UTSW 7 79,344,236 (GRCm39) missense probably damaging 0.99
R0595:Ticrr UTSW 7 79,345,311 (GRCm39) missense possibly damaging 0.94
R1118:Ticrr UTSW 7 79,343,701 (GRCm39) missense probably benign 0.23
R1119:Ticrr UTSW 7 79,343,701 (GRCm39) missense probably benign 0.23
R1572:Ticrr UTSW 7 79,331,572 (GRCm39) missense probably damaging 1.00
R1658:Ticrr UTSW 7 79,345,297 (GRCm39) missense possibly damaging 0.57
R1757:Ticrr UTSW 7 79,328,794 (GRCm39) nonsense probably null
R1757:Ticrr UTSW 7 79,325,071 (GRCm39) missense probably damaging 0.99
R1862:Ticrr UTSW 7 79,344,955 (GRCm39) missense probably damaging 1.00
R1869:Ticrr UTSW 7 79,328,883 (GRCm39) missense probably damaging 1.00
R1938:Ticrr UTSW 7 79,325,142 (GRCm39) missense probably damaging 0.98
R1966:Ticrr UTSW 7 79,344,483 (GRCm39) nonsense probably null
R2006:Ticrr UTSW 7 79,343,821 (GRCm39) missense possibly damaging 0.93
R2178:Ticrr UTSW 7 79,315,433 (GRCm39) missense probably benign 0.12
R3404:Ticrr UTSW 7 79,344,539 (GRCm39) missense probably benign 0.06
R3405:Ticrr UTSW 7 79,344,539 (GRCm39) missense probably benign 0.06
R3941:Ticrr UTSW 7 79,343,445 (GRCm39) intron probably benign
R3950:Ticrr UTSW 7 79,331,817 (GRCm39) missense probably damaging 1.00
R3951:Ticrr UTSW 7 79,331,817 (GRCm39) missense probably damaging 1.00
R3952:Ticrr UTSW 7 79,331,817 (GRCm39) missense probably damaging 1.00
R4967:Ticrr UTSW 7 79,310,158 (GRCm39) missense probably damaging 0.99
R4972:Ticrr UTSW 7 79,319,416 (GRCm39) missense probably damaging 0.98
R5259:Ticrr UTSW 7 79,344,471 (GRCm39) missense probably benign 0.01
R5272:Ticrr UTSW 7 79,319,353 (GRCm39) missense probably benign 0.44
R5374:Ticrr UTSW 7 79,340,690 (GRCm39) nonsense probably null
R5480:Ticrr UTSW 7 79,310,557 (GRCm39) missense probably damaging 1.00
R5568:Ticrr UTSW 7 79,345,044 (GRCm39) nonsense probably null
R5568:Ticrr UTSW 7 79,339,715 (GRCm39) critical splice donor site probably null
R5588:Ticrr UTSW 7 79,328,853 (GRCm39) missense probably damaging 1.00
R5698:Ticrr UTSW 7 79,328,881 (GRCm39) missense probably benign
R5879:Ticrr UTSW 7 79,346,438 (GRCm39) missense probably benign 0.12
R5980:Ticrr UTSW 7 79,310,703 (GRCm39) missense probably damaging 0.99
R6128:Ticrr UTSW 7 79,343,716 (GRCm39) missense probably damaging 1.00
R6277:Ticrr UTSW 7 79,344,444 (GRCm39) missense probably benign 0.00
R6335:Ticrr UTSW 7 79,344,031 (GRCm39) splice site probably null
R6866:Ticrr UTSW 7 79,343,705 (GRCm39) missense possibly damaging 0.47
R6905:Ticrr UTSW 7 79,315,598 (GRCm39) missense probably benign 0.00
R6923:Ticrr UTSW 7 79,341,601 (GRCm39) missense probably damaging 0.98
R6962:Ticrr UTSW 7 79,315,645 (GRCm39) missense possibly damaging 0.84
R7232:Ticrr UTSW 7 79,343,490 (GRCm39) missense probably damaging 0.96
R7285:Ticrr UTSW 7 79,310,610 (GRCm39) missense possibly damaging 0.93
R7385:Ticrr UTSW 7 79,341,597 (GRCm39) missense possibly damaging 0.93
R7426:Ticrr UTSW 7 79,343,734 (GRCm39) missense probably benign
R7749:Ticrr UTSW 7 79,328,844 (GRCm39) missense possibly damaging 0.94
R7863:Ticrr UTSW 7 79,331,760 (GRCm39) missense possibly damaging 0.92
R7899:Ticrr UTSW 7 79,319,233 (GRCm39) missense probably benign 0.23
R7935:Ticrr UTSW 7 79,331,584 (GRCm39) missense probably damaging 0.99
R8005:Ticrr UTSW 7 79,343,796 (GRCm39) missense probably damaging 0.98
R8080:Ticrr UTSW 7 79,334,012 (GRCm39) splice site probably null
R8181:Ticrr UTSW 7 79,310,728 (GRCm39) missense possibly damaging 0.92
R8349:Ticrr UTSW 7 79,344,428 (GRCm39) missense probably benign 0.27
R8410:Ticrr UTSW 7 79,317,423 (GRCm39) missense probably damaging 0.98
R8449:Ticrr UTSW 7 79,344,428 (GRCm39) missense probably benign 0.27
R9073:Ticrr UTSW 7 79,317,679 (GRCm39) missense probably benign 0.01
R9090:Ticrr UTSW 7 79,310,604 (GRCm39) missense possibly damaging 0.85
R9271:Ticrr UTSW 7 79,310,604 (GRCm39) missense possibly damaging 0.85
R9287:Ticrr UTSW 7 79,343,516 (GRCm39) missense possibly damaging 0.89
R9368:Ticrr UTSW 7 79,330,735 (GRCm39) missense probably damaging 0.99
R9469:Ticrr UTSW 7 79,344,511 (GRCm39) missense probably benign 0.03
R9502:Ticrr UTSW 7 79,343,597 (GRCm39) missense probably benign
R9614:Ticrr UTSW 7 79,345,754 (GRCm39) missense probably damaging 1.00
R9761:Ticrr UTSW 7 79,345,313 (GRCm39) missense probably damaging 1.00
R9779:Ticrr UTSW 7 79,328,802 (GRCm39) missense probably benign 0.37
Predicted Primers PCR Primer
(F):5'- AGTTGCTTGTCACTGCCAGC -3'
(R):5'- GAACTTTCTCAGTCCCATGAAGTC -3'

Sequencing Primer
(F):5'- CCAGCGTGTAACCCTTAAGAGTG -3'
(R):5'- CACTCGTGTTCTGGGCACAATG -3'
Posted On 2019-10-24