Incidental Mutation 'R0621:Atxn7l1'
ID58689
Institutional Source Beutler Lab
Gene Symbol Atxn7l1
Ensembl Gene ENSMUSG00000020564
Gene Nameataxin 7-like 1
SynonymsAtxn7l4, 2810423G08Rik
MMRRC Submission 038810-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.114) question?
Stock #R0621 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location33147693-33373185 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 33326100 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 131 (V131A)
Ref Sequence ENSEMBL: ENSMUSP00000151520 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090597] [ENSMUST00000125192] [ENSMUST00000136644] [ENSMUST00000144586] [ENSMUST00000146040] [ENSMUST00000154742]
Predicted Effect probably benign
Transcript: ENSMUST00000090597
AA Change: V58A

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000088085
Gene: ENSMUSG00000020564
AA Change: V58A

DomainStartEndE-ValueType
low complexity region 4 13 N/A INTRINSIC
low complexity region 95 110 N/A INTRINSIC
Pfam:SCA7 143 220 2.5e-31 PFAM
low complexity region 274 288 N/A INTRINSIC
low complexity region 380 392 N/A INTRINSIC
low complexity region 471 501 N/A INTRINSIC
low complexity region 519 538 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000125192
AA Change: V154A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000118777
Gene: ENSMUSG00000020564
AA Change: V154A

DomainStartEndE-ValueType
low complexity region 95 114 N/A INTRINSIC
low complexity region 191 206 N/A INTRINSIC
Pfam:SCA7 246 314 2e-28 PFAM
low complexity region 370 384 N/A INTRINSIC
low complexity region 476 488 N/A INTRINSIC
low complexity region 567 597 N/A INTRINSIC
low complexity region 615 634 N/A INTRINSIC
low complexity region 792 810 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130740
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133549
SMART Domains Protein: ENSMUSP00000120569
Gene: ENSMUSG00000020564

DomainStartEndE-ValueType
low complexity region 4 13 N/A INTRINSIC
low complexity region 95 110 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000136644
AA Change: V131A

PolyPhen 2 Score 0.148 (Sensitivity: 0.92; Specificity: 0.87)
Predicted Effect probably benign
Transcript: ENSMUST00000144586
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145589
Predicted Effect probably benign
Transcript: ENSMUST00000146040
AA Change: V154A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000122156
Gene: ENSMUSG00000020564
AA Change: V154A

DomainStartEndE-ValueType
low complexity region 95 114 N/A INTRINSIC
low complexity region 191 206 N/A INTRINSIC
Pfam:SCA7 246 314 2.3e-28 PFAM
low complexity region 370 384 N/A INTRINSIC
low complexity region 526 540 N/A INTRINSIC
low complexity region 578 590 N/A INTRINSIC
low complexity region 669 699 N/A INTRINSIC
low complexity region 717 736 N/A INTRINSIC
low complexity region 894 912 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000154742
AA Change: V58A

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000122982
Gene: ENSMUSG00000020564
AA Change: V58A

DomainStartEndE-ValueType
low complexity region 4 13 N/A INTRINSIC
low complexity region 95 110 N/A INTRINSIC
Pfam:SCA7 150 218 1.3e-31 PFAM
low complexity region 274 288 N/A INTRINSIC
low complexity region 380 392 N/A INTRINSIC
low complexity region 471 501 N/A INTRINSIC
low complexity region 519 538 N/A INTRINSIC
low complexity region 696 714 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155386
SMART Domains Protein: ENSMUSP00000115463
Gene: ENSMUSG00000020564

DomainStartEndE-ValueType
low complexity region 14 33 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 99.0%
  • 10x: 97.8%
  • 20x: 96.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abr T C 11: 76,509,072 D33G probably damaging Het
Adgre1 T A 17: 57,441,359 S520T probably damaging Het
Ankrd40 A G 11: 94,339,607 probably null Het
Aph1b A T 9: 66,779,334 I177K possibly damaging Het
Armc3 A T 2: 19,295,393 N579I probably damaging Het
C130073F10Rik A G 4: 101,890,795 Y61H probably damaging Het
C1s2 A T 6: 124,631,112 L214Q probably damaging Het
Caprin2 A T 6: 148,858,678 S425T possibly damaging Het
Cdc42ep4 G A 11: 113,728,696 R290C probably damaging Het
Cenpf T C 1: 189,672,628 T352A probably benign Het
Col6a4 A T 9: 106,066,791 F1161L probably damaging Het
Dctn2 T C 10: 127,277,940 probably null Het
Ddx24 T C 12: 103,425,558 probably benign Het
Dsg1c C A 18: 20,279,695 A591D possibly damaging Het
Efnb3 T C 11: 69,555,972 D304G probably damaging Het
Erbb3 T C 10: 128,586,225 Y50C probably benign Het
Eya3 T G 4: 132,694,802 D275E probably benign Het
Fam81a G T 9: 70,093,647 Q272K probably benign Het
Foxf1 T C 8: 121,085,180 V261A probably damaging Het
Gm9637 G A 14: 19,402,011 noncoding transcript Het
Gnb4 C T 3: 32,591,207 V112I probably benign Het
Gtf2h2 A T 13: 100,488,925 L61Q probably damaging Het
Hey2 T A 10: 30,834,386 I124F probably benign Het
Hoxb3 A T 11: 96,345,963 Y289F probably damaging Het
Kctd3 C T 1: 188,981,341 R399Q probably damaging Het
Kif26b C G 1: 178,915,653 P1105A probably benign Het
Klhl30 C T 1: 91,357,863 T369M probably damaging Het
Lipo2 C T 19: 33,730,939 G225D probably damaging Het
Macf1 T C 4: 123,380,534 K6350E probably damaging Het
Myh13 A C 11: 67,341,232 N446T probably damaging Het
Nos1ap T C 1: 170,318,581 D468G probably damaging Het
Olfr1250 C A 2: 89,657,115 E109* probably null Het
Olfr418 C T 1: 173,270,675 P167S possibly damaging Het
Olfr746 G A 14: 50,653,962 G242R possibly damaging Het
Pde3a T C 6: 141,249,999 L137P probably damaging Het
Ppm1f G A 16: 16,915,308 R233Q probably benign Het
Rtf2 C A 2: 172,466,296 A205E possibly damaging Het
Sh2d5 T C 4: 138,258,318 F359S probably benign Het
Siglec1 G A 2: 131,074,268 T1254M probably benign Het
Slc39a11 G A 11: 113,464,079 P108L probably benign Het
Slc6a5 G A 7: 49,917,365 probably null Het
Snph C T 2: 151,593,722 V360M probably damaging Het
Snx29 A G 16: 11,405,787 probably null Het
Sos1 A G 17: 80,451,979 probably null Het
Spata5 C T 3: 37,432,029 T300I probably benign Het
St8sia6 T A 2: 13,657,282 N246I probably damaging Het
Thy1 T A 9: 44,046,733 F53I probably damaging Het
Tle3 T A 9: 61,410,105 Y421* probably null Het
Ttc21b C T 2: 66,226,011 R677Q probably benign Het
Vmn2r107 A T 17: 20,374,990 I602F probably benign Het
Wdr17 C A 8: 54,643,191 G1016C probably benign Het
Wdr62 T C 7: 30,254,061 E182G possibly damaging Het
Zfp597 A G 16: 3,866,364 I176T probably benign Het
Other mutations in Atxn7l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02130:Atxn7l1 APN 12 33342142 missense probably damaging 1.00
IGL02146:Atxn7l1 APN 12 33368031 missense probably benign
IGL02202:Atxn7l1 APN 12 33342078 missense probably benign 0.05
IGL02804:Atxn7l1 APN 12 33367789 missense probably damaging 1.00
IGL03344:Atxn7l1 APN 12 33326066 missense probably damaging 1.00
R0270:Atxn7l1 UTSW 12 33342151 missense possibly damaging 0.58
R1840:Atxn7l1 UTSW 12 33371033 splice site probably null
R1856:Atxn7l1 UTSW 12 33358770 missense probably damaging 1.00
R1992:Atxn7l1 UTSW 12 33358744 missense probably damaging 1.00
R1993:Atxn7l1 UTSW 12 33345977 missense probably benign
R2249:Atxn7l1 UTSW 12 33358840 missense probably damaging 1.00
R2369:Atxn7l1 UTSW 12 33358850 critical splice donor site probably null
R3695:Atxn7l1 UTSW 12 33358697 missense probably damaging 1.00
R3856:Atxn7l1 UTSW 12 33367600 missense probably damaging 1.00
R3976:Atxn7l1 UTSW 12 33325955 missense probably damaging 1.00
R4151:Atxn7l1 UTSW 12 33364482 missense probably damaging 0.96
R4301:Atxn7l1 UTSW 12 33367238 missense probably damaging 1.00
R4305:Atxn7l1 UTSW 12 33341992 missense probably damaging 0.99
R4411:Atxn7l1 UTSW 12 33194887 intron probably benign
R4763:Atxn7l1 UTSW 12 33358878 intron probably benign
R5049:Atxn7l1 UTSW 12 33358687 missense probably benign 0.00
R5090:Atxn7l1 UTSW 12 33326078 missense probably damaging 1.00
R5134:Atxn7l1 UTSW 12 33372876 missense probably damaging 1.00
R5425:Atxn7l1 UTSW 12 33367120 missense probably damaging 1.00
R6161:Atxn7l1 UTSW 12 33358663 missense possibly damaging 0.62
R6813:Atxn7l1 UTSW 12 33367124 missense probably damaging 0.96
R7248:Atxn7l1 UTSW 12 33367195 missense probably benign 0.26
R7328:Atxn7l1 UTSW 12 33148503 critical splice donor site probably null
R8020:Atxn7l1 UTSW 12 33325953 missense probably benign 0.10
R8057:Atxn7l1 UTSW 12 33326002 missense probably damaging 0.99
R8353:Atxn7l1 UTSW 12 33147883 missense probably damaging 0.99
R8523:Atxn7l1 UTSW 12 33346024 missense probably benign
Z1176:Atxn7l1 UTSW 12 33367645 missense probably benign 0.00
Z1176:Atxn7l1 UTSW 12 33368017 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCAGAGTCCTGCTTTGTACCTGTG -3'
(R):5'- AACCAAGGAGCCCTTCCCTGTTAC -3'

Sequencing Primer
(F):5'- TTTCTCCCCTGTAGAGAGAAGAC -3'
(R):5'- TAGGCACATACAGCTCGGTTC -3'
Posted On2013-07-11