Incidental Mutation 'R7583:Ap3d1'
ID586899
Institutional Source Beutler Lab
Gene Symbol Ap3d1
Ensembl Gene ENSMUSG00000020198
Gene Nameadaptor-related protein complex 3, delta 1 subunit
SynonymsmBLVR1, Bolvr
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.926) question?
Stock #R7583 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location80706956-80742264 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 80709458 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 1053 (T1053I)
Ref Sequence ENSEMBL: ENSMUSP00000020420 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020420] [ENSMUST00000218184] [ENSMUST00000218610]
Predicted Effect probably benign
Transcript: ENSMUST00000020420
AA Change: T1053I

PolyPhen 2 Score 0.127 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000020420
Gene: ENSMUSG00000020198
AA Change: T1053I

DomainStartEndE-ValueType
Pfam:Adaptin_N 32 583 6.6e-153 PFAM
Pfam:Cnd1 130 292 2.1e-8 PFAM
low complexity region 629 642 N/A INTRINSIC
BLVR 660 803 5.3e-80 SMART
low complexity region 835 861 N/A INTRINSIC
low complexity region 871 881 N/A INTRINSIC
coiled coil region 910 933 N/A INTRINSIC
low complexity region 947 964 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000095426
SMART Domains Protein: ENSMUSP00000093076
Gene: ENSMUSG00000055862

DomainStartEndE-ValueType
Pfam:IZUMO 26 167 1.1e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000218184
Predicted Effect probably benign
Transcript: ENSMUST00000218330
Predicted Effect probably benign
Transcript: ENSMUST00000218610
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 99% (95/96)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a subunit of the AP3 adaptor-like complex, which is not clathrin-associated, but is associated with the golgi region, as well as more peripheral structures. The AP-3 complex facilitates the budding of vesicles from the golgi membrane, and may be directly involved in trafficking to lysosomes. This subunit is implicated in intracellular biogenesis and trafficking of pigment granules, and possibly platelet dense granules and neurotransmitter vesicles. Defects in this gene are a cause of a new type of Hermansky-Pudlak syndrome. [provided by RefSeq, Feb 2017]
PHENOTYPE: Mutant mice show coat and eye color dilution, platelet defects, lysosomal abnormalities, inner ear degeneration and neurological defects and model Hermansky-Pudlak storage pool deficiency syndrome. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 98 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik A T 2: 68,739,326 D462V probably damaging Het
Abcc1 T C 16: 14,404,038 W222R probably damaging Het
Adamts13 A G 2: 26,973,953 K48E probably benign Het
Adgrd1 A C 5: 129,179,588 T674P probably benign Het
Agbl4 A T 4: 111,118,953 Y169F possibly damaging Het
Ahnak T A 19: 9,006,093 N1580K possibly damaging Het
Angptl8 A C 9: 21,835,914 probably null Het
Atad2 T C 15: 58,126,664 T139A probably benign Het
Bdp1 T A 13: 100,049,812 T1711S probably damaging Het
Bod1l T C 5: 41,833,790 I141V probably damaging Het
Cavin2 A T 1: 51,289,618 N78I possibly damaging Het
Ccnb1 T C 13: 100,779,754 H406R probably benign Het
Cd200r4 A G 16: 44,833,421 T194A probably damaging Het
Cdt1 G A 8: 122,570,256 R263H probably damaging Het
Cep85l A T 10: 53,281,354 I751N probably damaging Het
Clasp2 A G 9: 113,908,687 D1043G probably benign Het
Cmip A T 8: 117,454,952 N578I probably damaging Het
Col2a1 T G 15: 97,976,184 K1440N unknown Het
Cpne2 A T 8: 94,555,581 M252L probably benign Het
Crb2 A G 2: 37,790,595 T512A probably benign Het
Csmd1 A G 8: 15,998,833 Y2290H probably damaging Het
Ctnnd1 A T 2: 84,612,061 D642E probably damaging Het
Ctns A G 11: 73,188,470 S141P probably benign Het
Cwh43 A G 5: 73,434,289 Q575R probably benign Het
Cyp2b19 C A 7: 26,759,064 T68K probably damaging Het
Dcaf6 A G 1: 165,333,310 S849P probably damaging Het
Dnm3 T A 1: 162,477,774 Q17L possibly damaging Het
Enpp3 A T 10: 24,836,092 M1K probably null Het
Fam124a T A 14: 62,606,559 C505* probably null Het
Fam160b1 T A 19: 57,378,602 D192E probably benign Het
Fsip2 A G 2: 82,975,241 I635V probably benign Het
Gm5878 A T 6: 85,118,700 probably null Het
Gm6205 A T 5: 94,682,894 T84S possibly damaging Het
Gpld1 C A 13: 24,975,760 A437D probably damaging Het
Grk5 G T 19: 61,083,204 V401L possibly damaging Het
Gucy2g A T 19: 55,235,615 L259Q probably damaging Het
Habp2 T A 19: 56,311,804 D191E probably benign Het
Helz2 T A 2: 181,237,572 H751L probably benign Het
Hgsnat A G 8: 25,971,564 probably null Het
Hivep1 T A 13: 42,164,240 V2064E probably damaging Het
Ikbke C T 1: 131,276,479 A26T probably damaging Het
Ivd C A 2: 118,862,131 D37E probably damaging Het
Kif26b G A 1: 178,530,445 W40* probably null Het
Klrc2 A G 6: 129,659,311 S114P probably damaging Het
Lama1 A T 17: 67,761,621 T772S Het
Lamc1 T A 1: 153,243,232 K880N possibly damaging Het
Lmf1 G A 17: 25,655,449 D12N Het
Lpin2 G T 17: 71,231,396 E384* probably null Het
Lrrc23 T C 6: 124,779,578 probably benign Het
Lrrc31 T C 3: 30,691,099 probably null Het
Luc7l2 A G 6: 38,551,885 Q13R probably damaging Het
Ly6c1 G T 15: 75,048,497 H5Q probably damaging Het
Lyst A T 13: 13,635,887 H714L probably damaging Het
Man2a2 C T 7: 80,366,944 R374H probably damaging Het
Mchr1 A T 15: 81,237,441 T131S probably benign Het
Msto1 T C 3: 88,912,929 probably null Het
Myh1 C T 11: 67,220,913 T1698I probably benign Het
Ncapd3 G T 9: 27,071,848 C964F probably damaging Het
Nefh T C 11: 4,941,089 E510G probably damaging Het
Olfr1246 A T 2: 89,590,751 Y121* probably null Het
Olfr1513 T C 14: 52,349,903 T48A possibly damaging Het
Olfr357 A C 2: 36,997,080 K90T probably damaging Het
Olfr362 A T 2: 37,105,527 L41* probably null Het
Olfr538 A G 7: 140,574,210 E19G probably benign Het
P4ha1 T A 10: 59,369,640 S497R probably benign Het
Palb2 T C 7: 122,127,342 D435G probably benign Het
Papola C T 12: 105,811,045 P282L probably damaging Het
Pcdhgb1 A G 18: 37,682,324 R623G probably damaging Het
Pcolce T G 5: 137,607,445 K229Q probably benign Het
Pkhd1l1 T C 15: 44,568,364 probably null Het
Ppp6r3 T A 19: 3,490,790 T443S probably benign Het
Psg20 T A 7: 18,682,483 D236V probably damaging Het
Ptgr2 T G 12: 84,308,405 S304R probably damaging Het
Ptpn22 A T 3: 103,902,114 D681V probably benign Het
Rab3gap1 T C 1: 127,930,875 S574P probably benign Het
Slc36a1 A G 11: 55,213,928 probably null Het
Slc9a5 A G 8: 105,363,272 S621G possibly damaging Het
Sntg1 A G 1: 8,445,025 probably null Het
Snx17 A G 5: 31,196,533 N222D possibly damaging Het
Spata19 G T 9: 27,400,433 S116I possibly damaging Het
Spn G A 7: 127,137,062 A91V probably damaging Het
Srrm3 T C 5: 135,852,281 V145A probably benign Het
St7 A T 6: 17,942,754 T575S possibly damaging Het
Taf2 A T 15: 55,064,676 Y110* probably null Het
Tcf20 T C 15: 82,855,276 E658G possibly damaging Het
Tdrd6 G T 17: 43,624,238 A1973E probably benign Het
Tg T G 15: 66,764,418 L2237W probably damaging Het
Ticrr C A 7: 79,696,739 Y1882* probably null Het
Trim45 T A 3: 100,925,023 C191S probably damaging Het
Upf3a G A 8: 13,785,889 probably null Het
Vmn2r42 A T 7: 8,194,741 L293* probably null Het
Vmn2r62 T A 7: 42,788,042 Q339H possibly damaging Het
Wdr24 A T 17: 25,825,830 R220W probably null Het
Wdr5 T A 2: 27,518,775 S22T probably benign Het
Zfp37 G A 4: 62,192,016 probably benign Het
Zfp735 A T 11: 73,711,107 L292F possibly damaging Het
Zfp985 T A 4: 147,583,489 C271* probably null Het
Zranb1 G A 7: 132,983,896 R691Q probably benign Het
Other mutations in Ap3d1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Ap3d1 APN 10 80741979 missense probably benign 0.00
IGL00827:Ap3d1 APN 10 80713559 missense possibly damaging 0.92
IGL01668:Ap3d1 APN 10 80719159 missense possibly damaging 0.95
IGL01934:Ap3d1 APN 10 80709258 nonsense probably null
IGL03404:Ap3d1 APN 10 80730037 missense probably damaging 1.00
christian UTSW 10 80730042 missense probably damaging 1.00
R0119:Ap3d1 UTSW 10 80723615 splice site probably benign
R0197:Ap3d1 UTSW 10 80730042 missense probably damaging 1.00
R0356:Ap3d1 UTSW 10 80727978 missense probably damaging 1.00
R0372:Ap3d1 UTSW 10 80723567 missense probably damaging 1.00
R0491:Ap3d1 UTSW 10 80719241 missense probably damaging 1.00
R0636:Ap3d1 UTSW 10 80719382 nonsense probably null
R0792:Ap3d1 UTSW 10 80708479 missense probably benign
R0942:Ap3d1 UTSW 10 80732955 splice site probably benign
R1015:Ap3d1 UTSW 10 80716489 missense probably damaging 1.00
R1023:Ap3d1 UTSW 10 80714258 missense probably damaging 1.00
R1170:Ap3d1 UTSW 10 80732840 splice site probably benign
R1540:Ap3d1 UTSW 10 80715941 missense probably benign 0.00
R1639:Ap3d1 UTSW 10 80730010 missense probably damaging 0.98
R1664:Ap3d1 UTSW 10 80717737 nonsense probably null
R1669:Ap3d1 UTSW 10 80710836 unclassified probably benign
R1839:Ap3d1 UTSW 10 80727108 missense probably damaging 1.00
R1940:Ap3d1 UTSW 10 80709773 missense probably benign 0.03
R2081:Ap3d1 UTSW 10 80732936 missense probably damaging 1.00
R2258:Ap3d1 UTSW 10 80721132 missense probably benign 0.03
R2281:Ap3d1 UTSW 10 80713998 missense probably damaging 0.96
R2398:Ap3d1 UTSW 10 80719172 nonsense probably null
R2849:Ap3d1 UTSW 10 80741908 missense possibly damaging 0.65
R3856:Ap3d1 UTSW 10 80712185 missense probably benign
R4350:Ap3d1 UTSW 10 80719285 missense probably benign 0.15
R4590:Ap3d1 UTSW 10 80719812 nonsense probably null
R4782:Ap3d1 UTSW 10 80721586 splice site probably null
R4785:Ap3d1 UTSW 10 80712778 frame shift probably null
R4834:Ap3d1 UTSW 10 80719726 missense probably damaging 1.00
R4864:Ap3d1 UTSW 10 80712778 frame shift probably null
R5051:Ap3d1 UTSW 10 80719199 missense probably damaging 1.00
R5109:Ap3d1 UTSW 10 80709450 missense probably benign 0.11
R5219:Ap3d1 UTSW 10 80709817 missense probably benign 0.03
R5220:Ap3d1 UTSW 10 80727167 missense probably damaging 1.00
R5307:Ap3d1 UTSW 10 80723549 missense probably benign 0.29
R5586:Ap3d1 UTSW 10 80719130 missense possibly damaging 0.92
R5796:Ap3d1 UTSW 10 80714037 missense possibly damaging 0.70
R5905:Ap3d1 UTSW 10 80722927 missense possibly damaging 0.50
R6025:Ap3d1 UTSW 10 80710464 missense probably benign 0.01
R6028:Ap3d1 UTSW 10 80722927 missense possibly damaging 0.50
R6364:Ap3d1 UTSW 10 80710494 intron probably null
R6469:Ap3d1 UTSW 10 80712158 missense probably benign
R6603:Ap3d1 UTSW 10 80714047 missense probably benign 0.04
R6872:Ap3d1 UTSW 10 80714322 nonsense probably null
R6887:Ap3d1 UTSW 10 80723698 missense probably damaging 1.00
R7249:Ap3d1 UTSW 10 80741933 missense probably damaging 1.00
R7316:Ap3d1 UTSW 10 80717859 missense probably damaging 1.00
R7325:Ap3d1 UTSW 10 80723803 missense probably damaging 1.00
R7395:Ap3d1 UTSW 10 80730882 missense probably benign 0.11
R7405:Ap3d1 UTSW 10 80741900 missense probably benign 0.16
R7425:Ap3d1 UTSW 10 80721592 missense probably damaging 1.00
R7558:Ap3d1 UTSW 10 80722921 missense possibly damaging 0.92
R7703:Ap3d1 UTSW 10 80717844 missense probably damaging 1.00
R8021:Ap3d1 UTSW 10 80714301 missense probably benign 0.30
X0019:Ap3d1 UTSW 10 80719102 missense probably damaging 1.00
X0026:Ap3d1 UTSW 10 80721147 missense possibly damaging 0.46
Z1088:Ap3d1 UTSW 10 80719237 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- GCTCCTTCATCATCCTGCAAGG -3'
(R):5'- AAGGCCCCAAGCTCTTGATG -3'

Sequencing Primer
(F):5'- TCCTGCAAGGAGAAAGGCTG -3'
(R):5'- GTGCTACTCTTGGGCCACATG -3'
Posted On2019-10-24