Mutagenetix > Incidental Mutations

Incidental Mutation 'R7583:Ap3d1'

586899

Institutional Source

Beutler Lab

Gene Symbol

Ap3d1

Ensembl Gene

ENSMUSG00000020198

Gene Name

adaptor-related protein complex 3, delta 1 subunit

Synonyms

mBLVR1, Bolvr

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.926) question?

Stock #

R7583 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

80706956-80742264 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 80709458 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Isoleucine at position 1053 (T1053I)

Ref Sequence

ENSEMBL: ENSMUSP00000020420 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020420] [ENSMUST00000218184] [ENSMUST00000218610]

Predicted Effect

probably benign
Transcript: ENSMUST00000020420
AA Change: T1053I

PolyPhen 2 Score 0.127 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000020420
Gene: ENSMUSG00000020198
AA Change: T1053I

Domain	Start	End	E-Value	Type
Pfam:Adaptin_N	32	583	6.6e-153	PFAM
Pfam:Cnd1	130	292	2.1e-8	PFAM
low complexity region	629	642	N/A	INTRINSIC
BLVR	660	803	5.3e-80	SMART
low complexity region	835	861	N/A	INTRINSIC
low complexity region	871	881	N/A	INTRINSIC
coiled coil region	910	933	N/A	INTRINSIC
low complexity region	947	964	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000095426

SMART Domains

Protein: ENSMUSP00000093076
Gene: ENSMUSG00000055862

Domain	Start	End	E-Value	Type
Pfam:IZUMO	26	167	1.1e-31	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000218184

Predicted Effect

probably benign
Transcript: ENSMUST00000218330

Predicted Effect

probably benign
Transcript: ENSMUST00000218610

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.9%

Validation Efficiency

99% (95/96)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a subunit of the AP3 adaptor-like complex, which is not clathrin-associated, but is associated with the golgi region, as well as more peripheral structures. The AP-3 complex facilitates the budding of vesicles from the golgi membrane, and may be directly involved in trafficking to lysosomes. This subunit is implicated in intracellular biogenesis and trafficking of pigment granules, and possibly platelet dense granules and neurotransmitter vesicles. Defects in this gene are a cause of a new type of Hermansky-Pudlak syndrome. [provided by RefSeq, Feb 2017]
PHENOTYPE: Mutant mice show coat and eye color dilution, platelet defects, lysosomal abnormalities, inner ear degeneration and neurological defects and model Hermansky-Pudlak storage pool deficiency syndrome. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 98 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932414N04Rik	A	T	2: 68,739,326	D462V	probably damaging	Het
Abcc1	T	C	16: 14,404,038	W222R	probably damaging	Het
Adamts13	A	G	2: 26,973,953	K48E	probably benign	Het
Adgrd1	A	C	5: 129,179,588	T674P	probably benign	Het
Agbl4	A	T	4: 111,118,953	Y169F	possibly damaging	Het
Ahnak	T	A	19: 9,006,093	N1580K	possibly damaging	Het
Angptl8	A	C	9: 21,835,914		probably null	Het
Atad2	T	C	15: 58,126,664	T139A	probably benign	Het
Bdp1	T	A	13: 100,049,812	T1711S	probably damaging	Het
Bod1l	T	C	5: 41,833,790	I141V	probably damaging	Het
Cavin2	A	T	1: 51,289,618	N78I	possibly damaging	Het
Ccnb1	T	C	13: 100,779,754	H406R	probably benign	Het
Cd200r4	A	G	16: 44,833,421	T194A	probably damaging	Het
Cdt1	G	A	8: 122,570,256	R263H	probably damaging	Het
Cep85l	A	T	10: 53,281,354	I751N	probably damaging	Het
Clasp2	A	G	9: 113,908,687	D1043G	probably benign	Het
Cmip	A	T	8: 117,454,952	N578I	probably damaging	Het
Col2a1	T	G	15: 97,976,184	K1440N	unknown	Het
Cpne2	A	T	8: 94,555,581	M252L	probably benign	Het
Crb2	A	G	2: 37,790,595	T512A	probably benign	Het
Csmd1	A	G	8: 15,998,833	Y2290H	probably damaging	Het
Ctnnd1	A	T	2: 84,612,061	D642E	probably damaging	Het
Ctns	A	G	11: 73,188,470	S141P	probably benign	Het
Cwh43	A	G	5: 73,434,289	Q575R	probably benign	Het
Cyp2b19	C	A	7: 26,759,064	T68K	probably damaging	Het
Dcaf6	A	G	1: 165,333,310	S849P	probably damaging	Het
Dnm3	T	A	1: 162,477,774	Q17L	possibly damaging	Het
Enpp3	A	T	10: 24,836,092	M1K	probably null	Het
Fam124a	T	A	14: 62,606,559	C505*	probably null	Het
Fam160b1	T	A	19: 57,378,602	D192E	probably benign	Het
Fsip2	A	G	2: 82,975,241	I635V	probably benign	Het
Gm5878	A	T	6: 85,118,700		probably null	Het
Gm6205	A	T	5: 94,682,894	T84S	possibly damaging	Het
Gpld1	C	A	13: 24,975,760	A437D	probably damaging	Het
Grk5	G	T	19: 61,083,204	V401L	possibly damaging	Het
Gucy2g	A	T	19: 55,235,615	L259Q	probably damaging	Het
Habp2	T	A	19: 56,311,804	D191E	probably benign	Het
Helz2	T	A	2: 181,237,572	H751L	probably benign	Het
Hgsnat	A	G	8: 25,971,564		probably null	Het
Hivep1	T	A	13: 42,164,240	V2064E	probably damaging	Het
Ikbke	C	T	1: 131,276,479	A26T	probably damaging	Het
Ivd	C	A	2: 118,862,131	D37E	probably damaging	Het
Kif26b	G	A	1: 178,530,445	W40*	probably null	Het
Klrc2	A	G	6: 129,659,311	S114P	probably damaging	Het
Lama1	A	T	17: 67,761,621	T772S		Het
Lamc1	T	A	1: 153,243,232	K880N	possibly damaging	Het
Lmf1	G	A	17: 25,655,449	D12N		Het
Lpin2	G	T	17: 71,231,396	E384*	probably null	Het
Lrrc23	T	C	6: 124,779,578		probably benign	Het
Lrrc31	T	C	3: 30,691,099		probably null	Het
Luc7l2	A	G	6: 38,551,885	Q13R	probably damaging	Het
Ly6c1	G	T	15: 75,048,497	H5Q	probably damaging	Het
Lyst	A	T	13: 13,635,887	H714L	probably damaging	Het
Man2a2	C	T	7: 80,366,944	R374H	probably damaging	Het
Mchr1	A	T	15: 81,237,441	T131S	probably benign	Het
Msto1	T	C	3: 88,912,929		probably null	Het
Myh1	C	T	11: 67,220,913	T1698I	probably benign	Het
Ncapd3	G	T	9: 27,071,848	C964F	probably damaging	Het
Nefh	T	C	11: 4,941,089	E510G	probably damaging	Het
Olfr1246	A	T	2: 89,590,751	Y121*	probably null	Het
Olfr1513	T	C	14: 52,349,903	T48A	possibly damaging	Het
Olfr357	A	C	2: 36,997,080	K90T	probably damaging	Het
Olfr362	A	T	2: 37,105,527	L41*	probably null	Het
Olfr538	A	G	7: 140,574,210	E19G	probably benign	Het
P4ha1	T	A	10: 59,369,640	S497R	probably benign	Het
Palb2	T	C	7: 122,127,342	D435G	probably benign	Het
Papola	C	T	12: 105,811,045	P282L	probably damaging	Het
Pcdhgb1	A	G	18: 37,682,324	R623G	probably damaging	Het
Pcolce	T	G	5: 137,607,445	K229Q	probably benign	Het
Pkhd1l1	T	C	15: 44,568,364		probably null	Het
Ppp6r3	T	A	19: 3,490,790	T443S	probably benign	Het
Psg20	T	A	7: 18,682,483	D236V	probably damaging	Het
Ptgr2	T	G	12: 84,308,405	S304R	probably damaging	Het
Ptpn22	A	T	3: 103,902,114	D681V	probably benign	Het
Rab3gap1	T	C	1: 127,930,875	S574P	probably benign	Het
Slc36a1	A	G	11: 55,213,928		probably null	Het
Slc9a5	A	G	8: 105,363,272	S621G	possibly damaging	Het
Sntg1	A	G	1: 8,445,025		probably null	Het
Snx17	A	G	5: 31,196,533	N222D	possibly damaging	Het
Spata19	G	T	9: 27,400,433	S116I	possibly damaging	Het
Spn	G	A	7: 127,137,062	A91V	probably damaging	Het
Srrm3	T	C	5: 135,852,281	V145A	probably benign	Het
St7	A	T	6: 17,942,754	T575S	possibly damaging	Het
Taf2	A	T	15: 55,064,676	Y110*	probably null	Het
Tcf20	T	C	15: 82,855,276	E658G	possibly damaging	Het
Tdrd6	G	T	17: 43,624,238	A1973E	probably benign	Het
Tg	T	G	15: 66,764,418	L2237W	probably damaging	Het
Ticrr	C	A	7: 79,696,739	Y1882*	probably null	Het
Trim45	T	A	3: 100,925,023	C191S	probably damaging	Het
Upf3a	G	A	8: 13,785,889		probably null	Het
Vmn2r42	A	T	7: 8,194,741	L293*	probably null	Het
Vmn2r62	T	A	7: 42,788,042	Q339H	possibly damaging	Het
Wdr24	A	T	17: 25,825,830	R220W	probably null	Het
Wdr5	T	A	2: 27,518,775	S22T	probably benign	Het
Zfp37	G	A	4: 62,192,016		probably benign	Het
Zfp735	A	T	11: 73,711,107	L292F	possibly damaging	Het
Zfp985	T	A	4: 147,583,489	C271*	probably null	Het
Zranb1	G	A	7: 132,983,896	R691Q	probably benign	Het

Other mutations in Ap3d1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00094:Ap3d1	APN	10	80741979	missense	probably benign	0.00
IGL00827:Ap3d1	APN	10	80713559	missense	possibly damaging	0.92
IGL01668:Ap3d1	APN	10	80719159	missense	possibly damaging	0.95
IGL01934:Ap3d1	APN	10	80709258	nonsense	probably null
IGL03404:Ap3d1	APN	10	80730037	missense	probably damaging	1.00
christian	UTSW	10	80730042	missense	probably damaging	1.00
R0119:Ap3d1	UTSW	10	80723615	splice site	probably benign
R0197:Ap3d1	UTSW	10	80730042	missense	probably damaging	1.00
R0356:Ap3d1	UTSW	10	80727978	missense	probably damaging	1.00
R0372:Ap3d1	UTSW	10	80723567	missense	probably damaging	1.00
R0491:Ap3d1	UTSW	10	80719241	missense	probably damaging	1.00
R0636:Ap3d1	UTSW	10	80719382	nonsense	probably null
R0792:Ap3d1	UTSW	10	80708479	missense	probably benign
R0942:Ap3d1	UTSW	10	80732955	splice site	probably benign
R1015:Ap3d1	UTSW	10	80716489	missense	probably damaging	1.00
R1023:Ap3d1	UTSW	10	80714258	missense	probably damaging	1.00
R1170:Ap3d1	UTSW	10	80732840	splice site	probably benign
R1540:Ap3d1	UTSW	10	80715941	missense	probably benign	0.00
R1639:Ap3d1	UTSW	10	80730010	missense	probably damaging	0.98
R1664:Ap3d1	UTSW	10	80717737	nonsense	probably null
R1669:Ap3d1	UTSW	10	80710836	unclassified	probably benign
R1839:Ap3d1	UTSW	10	80727108	missense	probably damaging	1.00
R1940:Ap3d1	UTSW	10	80709773	missense	probably benign	0.03
R2081:Ap3d1	UTSW	10	80732936	missense	probably damaging	1.00
R2258:Ap3d1	UTSW	10	80721132	missense	probably benign	0.03
R2281:Ap3d1	UTSW	10	80713998	missense	probably damaging	0.96
R2398:Ap3d1	UTSW	10	80719172	nonsense	probably null
R2849:Ap3d1	UTSW	10	80741908	missense	possibly damaging	0.65
R3856:Ap3d1	UTSW	10	80712185	missense	probably benign
R4350:Ap3d1	UTSW	10	80719285	missense	probably benign	0.15
R4590:Ap3d1	UTSW	10	80719812	nonsense	probably null
R4782:Ap3d1	UTSW	10	80721586	splice site	probably null
R4785:Ap3d1	UTSW	10	80712778	frame shift	probably null
R4834:Ap3d1	UTSW	10	80719726	missense	probably damaging	1.00
R4864:Ap3d1	UTSW	10	80712778	frame shift	probably null
R5051:Ap3d1	UTSW	10	80719199	missense	probably damaging	1.00
R5109:Ap3d1	UTSW	10	80709450	missense	probably benign	0.11
R5219:Ap3d1	UTSW	10	80709817	missense	probably benign	0.03
R5220:Ap3d1	UTSW	10	80727167	missense	probably damaging	1.00
R5307:Ap3d1	UTSW	10	80723549	missense	probably benign	0.29
R5586:Ap3d1	UTSW	10	80719130	missense	possibly damaging	0.92
R5796:Ap3d1	UTSW	10	80714037	missense	possibly damaging	0.70
R5905:Ap3d1	UTSW	10	80722927	missense	possibly damaging	0.50
R6025:Ap3d1	UTSW	10	80710464	missense	probably benign	0.01
R6028:Ap3d1	UTSW	10	80722927	missense	possibly damaging	0.50
R6364:Ap3d1	UTSW	10	80710494	intron	probably null
R6469:Ap3d1	UTSW	10	80712158	missense	probably benign
R6603:Ap3d1	UTSW	10	80714047	missense	probably benign	0.04
R6872:Ap3d1	UTSW	10	80714322	nonsense	probably null
R6887:Ap3d1	UTSW	10	80723698	missense	probably damaging	1.00
R7249:Ap3d1	UTSW	10	80741933	missense	probably damaging	1.00
R7316:Ap3d1	UTSW	10	80717859	missense	probably damaging	1.00
R7325:Ap3d1	UTSW	10	80723803	missense	probably damaging	1.00
R7395:Ap3d1	UTSW	10	80730882	missense	probably benign	0.11
R7405:Ap3d1	UTSW	10	80741900	missense	probably benign	0.16
R7425:Ap3d1	UTSW	10	80721592	missense	probably damaging	1.00
R7558:Ap3d1	UTSW	10	80722921	missense	possibly damaging	0.92
R7703:Ap3d1	UTSW	10	80717844	missense	probably damaging	1.00
R8021:Ap3d1	UTSW	10	80714301	missense	probably benign	0.30
X0019:Ap3d1	UTSW	10	80719102	missense	probably damaging	1.00
X0026:Ap3d1	UTSW	10	80721147	missense	possibly damaging	0.46
Z1088:Ap3d1	UTSW	10	80719237	missense	possibly damaging	0.91

Predicted Primers

PCR Primer
(F):5'- GCTCCTTCATCATCCTGCAAGG -3'
(R):5'- AAGGCCCCAAGCTCTTGATG -3'

Sequencing Primer
(F):5'- TCCTGCAAGGAGAAAGGCTG -3'
(R):5'- GTGCTACTCTTGGGCCACATG -3'

Posted On

2019-10-24