Incidental Mutation 'R7583:Gpld1'
ID586908
Institutional Source Beutler Lab
Gene Symbol Gpld1
Ensembl Gene ENSMUSG00000021340
Gene Nameglycosylphosphatidylinositol specific phospholipase D1
Synonyms6330541J12Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7583 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location24943152-24992501 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 24975760 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Aspartic acid at position 437 (A437D)
Ref Sequence ENSEMBL: ENSMUSP00000021773 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021773]
Predicted Effect probably damaging
Transcript: ENSMUST00000021773
AA Change: A437D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000021773
Gene: ENSMUSG00000021340
AA Change: A437D

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Zn_dep_PLPC 28 219 9.8e-28 PFAM
Int_alpha 377 435 7.21e-11 SMART
Int_alpha 446 503 7.43e-13 SMART
Int_alpha 509 565 7.86e-3 SMART
Int_alpha 576 643 4.09e0 SMART
Blast:Int_alpha 644 708 2e-24 BLAST
Int_alpha 716 774 1.86e-4 SMART
Blast:Int_alpha 789 837 1e-16 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Many proteins are tethered to the extracellular face of eukaryotic plasma membranes by a glycosylphosphatidylinositol (GPI) anchor. The GPI-anchor is a glycolipid found on many blood cells. The protein encoded by this gene is a GPI degrading enzyme. Glycosylphosphatidylinositol specific phospholipase D1 hydrolyzes the inositol phosphate linkage in proteins anchored by phosphatidylinositol glycans, thereby releasing the attached protein from the plasma membrane. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 96 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik A T 2: 68,739,326 D462V probably damaging Het
Abcc1 T C 16: 14,404,038 W222R probably damaging Het
Adamts13 A G 2: 26,973,953 K48E probably benign Het
Adgrd1 A C 5: 129,179,588 T674P probably benign Het
Agbl4 A T 4: 111,118,953 Y169F possibly damaging Het
Ahnak T A 19: 9,006,093 N1580K possibly damaging Het
Angptl8 A C 9: 21,835,914 probably null Het
Ap3d1 G A 10: 80,709,458 T1053I probably benign Het
Atad2 T C 15: 58,126,664 T139A probably benign Het
Bdp1 T A 13: 100,049,812 T1711S probably damaging Het
Bod1l T C 5: 41,833,790 I141V probably damaging Het
Cavin2 A T 1: 51,289,618 N78I possibly damaging Het
Ccnb1 T C 13: 100,779,754 H406R probably benign Het
Cd200r4 A G 16: 44,833,421 T194A probably damaging Het
Cdt1 G A 8: 122,570,256 R263H probably damaging Het
Cep85l A T 10: 53,281,354 I751N probably damaging Het
Clasp2 A G 9: 113,908,687 D1043G probably benign Het
Cmip A T 8: 117,454,952 N578I probably damaging Het
Col2a1 T G 15: 97,976,184 K1440N unknown Het
Cpne2 A T 8: 94,555,581 M252L probably benign Het
Crb2 A G 2: 37,790,595 T512A probably benign Het
Csmd1 A G 8: 15,998,833 Y2290H probably damaging Het
Ctnnd1 A T 2: 84,612,061 D642E probably damaging Het
Ctns A G 11: 73,188,470 S141P probably benign Het
Cwh43 A G 5: 73,434,289 Q575R probably benign Het
Cyp2b19 C A 7: 26,759,064 T68K probably damaging Het
Dcaf6 A G 1: 165,333,310 S849P probably damaging Het
Dnm3 T A 1: 162,477,774 Q17L possibly damaging Het
Enpp3 A T 10: 24,836,092 M1K probably null Het
Fam124a T A 14: 62,606,559 C505* probably null Het
Fam160b1 T A 19: 57,378,602 D192E probably benign Het
Frmd4a C CA 2: 4,594,597 probably null Het
Fsip2 A G 2: 82,975,241 I635V probably benign Het
Gm6205 A T 5: 94,682,894 T84S possibly damaging Het
Grk5 G T 19: 61,083,204 V401L possibly damaging Het
Gucy2g A T 19: 55,235,615 L259Q probably damaging Het
Habp2 T A 19: 56,311,804 D191E probably benign Het
Helz2 T A 2: 181,237,572 H751L probably benign Het
Hgsnat A G 8: 25,971,564 probably null Het
Hivep1 T A 13: 42,164,240 V2064E probably damaging Het
Ikbke C T 1: 131,276,479 A26T probably damaging Het
Ivd C A 2: 118,862,131 D37E probably damaging Het
Kif26b G A 1: 178,530,445 W40* probably null Het
Klrc2 A G 6: 129,659,311 S114P probably damaging Het
Lama1 A T 17: 67,761,621 T772S Het
Lamc1 T A 1: 153,243,232 K880N possibly damaging Het
Lmf1 G A 17: 25,655,449 D12N Het
Lpin2 G T 17: 71,231,396 E384* probably null Het
Lrrc23 T C 6: 124,779,578 probably benign Het
Luc7l2 A G 6: 38,551,885 Q13R probably damaging Het
Ly6c1 G T 15: 75,048,497 H5Q probably damaging Het
Lyst A T 13: 13,635,887 H714L probably damaging Het
Man2a2 C T 7: 80,366,944 R374H probably damaging Het
Mchr1 A T 15: 81,237,441 T131S probably benign Het
Msto1 T C 3: 88,912,929 probably null Het
Myh1 C T 11: 67,220,913 T1698I probably benign Het
Ncapd3 G T 9: 27,071,848 C964F probably damaging Het
Nefh T C 11: 4,941,089 E510G probably damaging Het
Olfr1246 A T 2: 89,590,751 Y121* probably null Het
Olfr1513 T C 14: 52,349,903 T48A possibly damaging Het
Olfr357 A C 2: 36,997,080 K90T probably damaging Het
Olfr362 A T 2: 37,105,527 L41* probably null Het
Olfr538 A G 7: 140,574,210 E19G probably benign Het
P4ha1 T A 10: 59,369,640 S497R probably benign Het
Palb2 T C 7: 122,127,342 D435G probably benign Het
Papola C T 12: 105,811,045 P282L probably damaging Het
Pcdhgb1 A G 18: 37,682,324 R623G probably damaging Het
Pcolce T G 5: 137,607,445 K229Q probably benign Het
Pkhd1l1 T C 15: 44,568,364 probably null Het
Ppp6r3 T A 19: 3,490,790 T443S probably benign Het
Psg20 T A 7: 18,682,483 D236V probably damaging Het
Ptgr2 T G 12: 84,308,405 S304R probably damaging Het
Ptpn22 A T 3: 103,902,114 D681V probably benign Het
Rab3gap1 T C 1: 127,930,875 S574P probably benign Het
Slc36a1 A G 11: 55,213,928 probably null Het
Slc9a5 A G 8: 105,363,272 S621G possibly damaging Het
Sntg1 A G 1: 8,445,025 probably null Het
Snx17 A G 5: 31,196,533 N222D possibly damaging Het
Spata19 G T 9: 27,400,433 S116I possibly damaging Het
Spn G A 7: 127,137,062 A91V probably damaging Het
Srrm3 T C 5: 135,852,281 V145A probably benign Het
St7 A T 6: 17,942,754 T575S possibly damaging Het
Taf2 A T 15: 55,064,676 Y110* probably null Het
Tcf20 T C 15: 82,855,276 E658G possibly damaging Het
Tdrd6 G T 17: 43,624,238 A1973E probably benign Het
Tg T G 15: 66,764,418 L2237W probably damaging Het
Ticrr C A 7: 79,696,739 Y1882* probably null Het
Trim45 T A 3: 100,925,023 C191S probably damaging Het
Vmn2r42 A T 7: 8,194,741 L293* probably null Het
Vmn2r62 T A 7: 42,788,042 Q339H possibly damaging Het
Wdr24 A T 17: 25,825,830 R220W probably null Het
Wdr5 T A 2: 27,518,775 S22T probably benign Het
Zfp37 G A 4: 62,192,016 probably benign Het
Zfp735 A T 11: 73,711,107 L292F possibly damaging Het
Zfp985 T A 4: 147,583,489 C271* probably null Het
Zranb1 G A 7: 132,983,896 R691Q probably benign Het
Other mutations in Gpld1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00433:Gpld1 APN 13 24986922 splice site probably benign
IGL00886:Gpld1 APN 13 24962353 nonsense probably null
IGL01060:Gpld1 APN 13 24982566 missense probably damaging 1.00
IGL01450:Gpld1 APN 13 24979681 missense probably damaging 1.00
IGL02176:Gpld1 APN 13 24984209 critical splice donor site probably null
IGL02288:Gpld1 APN 13 24979683 nonsense probably null
IGL02323:Gpld1 APN 13 24982774 missense probably damaging 0.97
IGL02588:Gpld1 APN 13 24943699 missense probably damaging 1.00
IGL02832:Gpld1 APN 13 24952878 missense probably damaging 1.00
IGL02989:Gpld1 APN 13 24990036 missense possibly damaging 0.87
IGL03282:Gpld1 APN 13 24971408 missense probably benign 0.01
IGL03345:Gpld1 APN 13 24987024 missense probably damaging 1.00
R0017:Gpld1 UTSW 13 24990118 missense probably damaging 1.00
R0017:Gpld1 UTSW 13 24990118 missense probably damaging 1.00
R0308:Gpld1 UTSW 13 24962835 missense possibly damaging 0.81
R0441:Gpld1 UTSW 13 24962320 nonsense probably null
R1172:Gpld1 UTSW 13 24957566 splice site probably null
R1411:Gpld1 UTSW 13 24962808 missense probably damaging 0.99
R1502:Gpld1 UTSW 13 24971416 missense probably benign 0.00
R1565:Gpld1 UTSW 13 24956068 missense probably damaging 0.99
R1931:Gpld1 UTSW 13 24943710 missense possibly damaging 0.71
R1999:Gpld1 UTSW 13 24962647 missense probably benign 0.23
R2150:Gpld1 UTSW 13 24962647 missense probably benign 0.23
R2240:Gpld1 UTSW 13 24982507 critical splice acceptor site probably null
R2327:Gpld1 UTSW 13 24984821 missense probably benign 0.00
R2373:Gpld1 UTSW 13 24962856 missense probably benign 0.26
R3153:Gpld1 UTSW 13 24943620 missense unknown
R3154:Gpld1 UTSW 13 24943620 missense unknown
R3154:Gpld1 UTSW 13 24956163 critical splice donor site probably null
R3911:Gpld1 UTSW 13 24962322 missense probably damaging 1.00
R4616:Gpld1 UTSW 13 24984816 missense probably damaging 1.00
R4660:Gpld1 UTSW 13 24982603 unclassified probably null
R4755:Gpld1 UTSW 13 24979688 missense probably benign 0.13
R4755:Gpld1 UTSW 13 24979692 nonsense probably null
R4835:Gpld1 UTSW 13 24982716 missense probably benign 0.00
R4895:Gpld1 UTSW 13 24979728 missense probably damaging 0.97
R5050:Gpld1 UTSW 13 24962756 missense probably benign 0.00
R5182:Gpld1 UTSW 13 24984070 unclassified probably null
R6161:Gpld1 UTSW 13 24971414 missense probably benign 0.00
R6626:Gpld1 UTSW 13 24979970 missense probably damaging 1.00
R7021:Gpld1 UTSW 13 24984708 missense probably damaging 1.00
R7577:Gpld1 UTSW 13 24962405 missense probably benign 0.05
R7659:Gpld1 UTSW 13 24979981 missense probably benign 0.00
R7737:Gpld1 UTSW 13 24975726 missense probably damaging 1.00
R7738:Gpld1 UTSW 13 24962322 missense probably damaging 1.00
R7752:Gpld1 UTSW 13 24962775 missense probably damaging 1.00
R7759:Gpld1 UTSW 13 24962400 missense probably damaging 0.99
X0024:Gpld1 UTSW 13 24982596 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGTAGCCCACAGCCCTCT -3'
(R):5'- TGCCAACTGTTACTGTAATTATTCTCC -3'

Sequencing Primer
(F):5'- ACAGCCCTCTCCTTCTCCTAAG -3'
(R):5'- CAGCGGTAGAGTACTTGTCTATACC -3'
Posted On2019-10-24