Incidental Mutation 'R7583:Bdp1'
ID586910
Institutional Source Beutler Lab
Gene Symbol Bdp1
Ensembl Gene ENSMUSG00000049658
Gene NameB double prime 1, subunit of RNA polymerase III transcription initiation factor IIIB
SynonymsTAF3B1, TFC5, Tfnr, B130055N23Rik, TFIIIB90, TFIIIB150, G630013P12Rik
MMRRC Submission
Accession Numbers

Genbank: NM_001081061; MGI: 1347077

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7583 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location100017994-100104070 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 100049812 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 1711 (T1711S)
Ref Sequence ENSEMBL: ENSMUSP00000105005 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038104] [ENSMUST00000109379]
Predicted Effect probably damaging
Transcript: ENSMUST00000038104
AA Change: T1711S

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000038321
Gene: ENSMUSG00000049658
AA Change: T1711S

DomainStartEndE-ValueType
low complexity region 25 45 N/A INTRINSIC
low complexity region 81 92 N/A INTRINSIC
low complexity region 147 164 N/A INTRINSIC
low complexity region 231 242 N/A INTRINSIC
SANT 301 349 1.52e-4 SMART
coiled coil region 375 399 N/A INTRINSIC
coiled coil region 457 487 N/A INTRINSIC
internal_repeat_1 593 895 3.56e-18 PROSPERO
coiled coil region 1013 1038 N/A INTRINSIC
internal_repeat_1 1253 1612 3.56e-18 PROSPERO
low complexity region 1718 1733 N/A INTRINSIC
low complexity region 1763 1774 N/A INTRINSIC
low complexity region 1912 1921 N/A INTRINSIC
low complexity region 2185 2199 N/A INTRINSIC
low complexity region 2335 2346 N/A INTRINSIC
low complexity region 2398 2412 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000099262
Predicted Effect probably damaging
Transcript: ENSMUST00000109379
AA Change: T1711S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105005
Gene: ENSMUSG00000049658
AA Change: T1711S

DomainStartEndE-ValueType
low complexity region 25 45 N/A INTRINSIC
low complexity region 81 92 N/A INTRINSIC
low complexity region 147 164 N/A INTRINSIC
low complexity region 231 242 N/A INTRINSIC
SANT 301 349 1.52e-4 SMART
coiled coil region 457 487 N/A INTRINSIC
internal_repeat_1 593 895 4.79e-19 PROSPERO
coiled coil region 1013 1038 N/A INTRINSIC
internal_repeat_1 1253 1612 4.79e-19 PROSPERO
low complexity region 1718 1733 N/A INTRINSIC
low complexity region 1763 1774 N/A INTRINSIC
low complexity region 1912 1921 N/A INTRINSIC
low complexity region 2185 2199 N/A INTRINSIC
low complexity region 2335 2346 N/A INTRINSIC
low complexity region 2398 2412 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 99% (95/96)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is a subunit of the TFIIIB transcription initiation complex, which recruits RNA polymerase III to target promoters in order to initiate transcription. The encoded protein localizes to concentrated aggregates in the nucleus, and is required for transcription from all three types of polymerase III promoters. It is phosphorylated by casein kinase II during mitosis, resulting in its release from chromatin and suppression of polymerase III transcription. [provided by RefSeq, Jul 2008]
Allele List at MGI

All alleles(4) : Gene trapped(4)

Other mutations in this stock
Total: 98 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik A T 2: 68,739,326 D462V probably damaging Het
Abcc1 T C 16: 14,404,038 W222R probably damaging Het
Adamts13 A G 2: 26,973,953 K48E probably benign Het
Adgrd1 A C 5: 129,179,588 T674P probably benign Het
Agbl4 A T 4: 111,118,953 Y169F possibly damaging Het
Ahnak T A 19: 9,006,093 N1580K possibly damaging Het
Angptl8 A C 9: 21,835,914 probably null Het
Ap3d1 G A 10: 80,709,458 T1053I probably benign Het
Atad2 T C 15: 58,126,664 T139A probably benign Het
Bod1l T C 5: 41,833,790 I141V probably damaging Het
Cavin2 A T 1: 51,289,618 N78I possibly damaging Het
Ccnb1 T C 13: 100,779,754 H406R probably benign Het
Cd200r4 A G 16: 44,833,421 T194A probably damaging Het
Cdt1 G A 8: 122,570,256 R263H probably damaging Het
Cep85l A T 10: 53,281,354 I751N probably damaging Het
Clasp2 A G 9: 113,908,687 D1043G probably benign Het
Cmip A T 8: 117,454,952 N578I probably damaging Het
Col2a1 T G 15: 97,976,184 K1440N unknown Het
Cpne2 A T 8: 94,555,581 M252L probably benign Het
Crb2 A G 2: 37,790,595 T512A probably benign Het
Csmd1 A G 8: 15,998,833 Y2290H probably damaging Het
Ctnnd1 A T 2: 84,612,061 D642E probably damaging Het
Ctns A G 11: 73,188,470 S141P probably benign Het
Cwh43 A G 5: 73,434,289 Q575R probably benign Het
Cyp2b19 C A 7: 26,759,064 T68K probably damaging Het
Dcaf6 A G 1: 165,333,310 S849P probably damaging Het
Dnm3 T A 1: 162,477,774 Q17L possibly damaging Het
Enpp3 A T 10: 24,836,092 M1K probably null Het
Fam124a T A 14: 62,606,559 C505* probably null Het
Fam160b1 T A 19: 57,378,602 D192E probably benign Het
Fsip2 A G 2: 82,975,241 I635V probably benign Het
Gm5878 A T 6: 85,118,700 probably null Het
Gm6205 A T 5: 94,682,894 T84S possibly damaging Het
Gpld1 C A 13: 24,975,760 A437D probably damaging Het
Grk5 G T 19: 61,083,204 V401L possibly damaging Het
Gucy2g A T 19: 55,235,615 L259Q probably damaging Het
Habp2 T A 19: 56,311,804 D191E probably benign Het
Helz2 T A 2: 181,237,572 H751L probably benign Het
Hgsnat A G 8: 25,971,564 probably null Het
Hivep1 T A 13: 42,164,240 V2064E probably damaging Het
Ikbke C T 1: 131,276,479 A26T probably damaging Het
Ivd C A 2: 118,862,131 D37E probably damaging Het
Kif26b G A 1: 178,530,445 W40* probably null Het
Klrc2 A G 6: 129,659,311 S114P probably damaging Het
Lama1 A T 17: 67,761,621 T772S Het
Lamc1 T A 1: 153,243,232 K880N possibly damaging Het
Lmf1 G A 17: 25,655,449 D12N Het
Lpin2 G T 17: 71,231,396 E384* probably null Het
Lrrc23 T C 6: 124,779,578 probably benign Het
Lrrc31 T C 3: 30,691,099 probably null Het
Luc7l2 A G 6: 38,551,885 Q13R probably damaging Het
Ly6c1 G T 15: 75,048,497 H5Q probably damaging Het
Lyst A T 13: 13,635,887 H714L probably damaging Het
Man2a2 C T 7: 80,366,944 R374H probably damaging Het
Mchr1 A T 15: 81,237,441 T131S probably benign Het
Msto1 T C 3: 88,912,929 probably null Het
Myh1 C T 11: 67,220,913 T1698I probably benign Het
Ncapd3 G T 9: 27,071,848 C964F probably damaging Het
Nefh T C 11: 4,941,089 E510G probably damaging Het
Olfr1246 A T 2: 89,590,751 Y121* probably null Het
Olfr1513 T C 14: 52,349,903 T48A possibly damaging Het
Olfr357 A C 2: 36,997,080 K90T probably damaging Het
Olfr362 A T 2: 37,105,527 L41* probably null Het
Olfr538 A G 7: 140,574,210 E19G probably benign Het
P4ha1 T A 10: 59,369,640 S497R probably benign Het
Palb2 T C 7: 122,127,342 D435G probably benign Het
Papola C T 12: 105,811,045 P282L probably damaging Het
Pcdhgb1 A G 18: 37,682,324 R623G probably damaging Het
Pcolce T G 5: 137,607,445 K229Q probably benign Het
Pkhd1l1 T C 15: 44,568,364 probably null Het
Ppp6r3 T A 19: 3,490,790 T443S probably benign Het
Psg20 T A 7: 18,682,483 D236V probably damaging Het
Ptgr2 T G 12: 84,308,405 S304R probably damaging Het
Ptpn22 A T 3: 103,902,114 D681V probably benign Het
Rab3gap1 T C 1: 127,930,875 S574P probably benign Het
Slc36a1 A G 11: 55,213,928 probably null Het
Slc9a5 A G 8: 105,363,272 S621G possibly damaging Het
Sntg1 A G 1: 8,445,025 probably null Het
Snx17 A G 5: 31,196,533 N222D possibly damaging Het
Spata19 G T 9: 27,400,433 S116I possibly damaging Het
Spn G A 7: 127,137,062 A91V probably damaging Het
Srrm3 T C 5: 135,852,281 V145A probably benign Het
St7 A T 6: 17,942,754 T575S possibly damaging Het
Taf2 A T 15: 55,064,676 Y110* probably null Het
Tcf20 T C 15: 82,855,276 E658G possibly damaging Het
Tdrd6 G T 17: 43,624,238 A1973E probably benign Het
Tg T G 15: 66,764,418 L2237W probably damaging Het
Ticrr C A 7: 79,696,739 Y1882* probably null Het
Trim45 T A 3: 100,925,023 C191S probably damaging Het
Upf3a G A 8: 13,785,889 probably null Het
Vmn2r42 A T 7: 8,194,741 L293* probably null Het
Vmn2r62 T A 7: 42,788,042 Q339H possibly damaging Het
Wdr24 A T 17: 25,825,830 R220W probably null Het
Wdr5 T A 2: 27,518,775 S22T probably benign Het
Zfp37 G A 4: 62,192,016 probably benign Het
Zfp735 A T 11: 73,711,107 L292F possibly damaging Het
Zfp985 T A 4: 147,583,489 C271* probably null Het
Zranb1 G A 7: 132,983,896 R691Q probably benign Het
Other mutations in Bdp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Bdp1 APN 13 100098510 missense probably damaging 1.00
IGL00096:Bdp1 APN 13 100060865 missense possibly damaging 0.61
IGL00160:Bdp1 APN 13 100061198 missense probably benign 0.00
IGL00924:Bdp1 APN 13 100097579 missense possibly damaging 0.89
IGL01337:Bdp1 APN 13 100056192 missense probably benign 0.00
IGL01344:Bdp1 APN 13 100078080 missense probably benign 0.06
IGL01347:Bdp1 APN 13 100070203 missense possibly damaging 0.79
IGL01620:Bdp1 APN 13 100084205 splice site probably benign
IGL01871:Bdp1 APN 13 100066053 missense probably benign 0.01
IGL02008:Bdp1 APN 13 100023827 missense possibly damaging 0.92
IGL02112:Bdp1 APN 13 100037800 missense probably benign 0.02
IGL02214:Bdp1 APN 13 100041535 missense probably benign 0.00
IGL02236:Bdp1 APN 13 100060891 missense probably benign
IGL02307:Bdp1 APN 13 100093438 missense probably damaging 1.00
IGL02364:Bdp1 APN 13 100055308 splice site probably benign
IGL02415:Bdp1 APN 13 100089408 missense probably damaging 0.96
IGL02601:Bdp1 APN 13 100098514 missense possibly damaging 0.72
IGL02605:Bdp1 APN 13 100078115 critical splice acceptor site probably null
IGL02664:Bdp1 APN 13 100051539 missense probably benign 0.29
IGL02738:Bdp1 APN 13 100051353 missense probably benign 0.26
IGL02754:Bdp1 APN 13 100060973 missense possibly damaging 0.94
IGL02967:Bdp1 APN 13 100042270 missense possibly damaging 0.92
IGL02974:Bdp1 APN 13 100055292 missense probably benign 0.00
IGL03156:Bdp1 APN 13 100061036 missense probably benign 0.44
IGL03166:Bdp1 APN 13 100035800 missense probably benign 0.28
IGL03232:Bdp1 APN 13 100051481 missense probably damaging 1.00
D3080:Bdp1 UTSW 13 100023621 missense probably benign 0.02
R0115:Bdp1 UTSW 13 100041454 missense probably benign 0.28
R0481:Bdp1 UTSW 13 100041454 missense probably benign 0.28
R0619:Bdp1 UTSW 13 100037858 missense probably benign 0.00
R0730:Bdp1 UTSW 13 100058951 splice site probably benign
R0744:Bdp1 UTSW 13 100035825 missense probably benign 0.01
R0833:Bdp1 UTSW 13 100035825 missense probably benign 0.01
R1307:Bdp1 UTSW 13 100049763 missense possibly damaging 0.89
R1325:Bdp1 UTSW 13 100099008 missense probably damaging 0.97
R1346:Bdp1 UTSW 13 100078755 nonsense probably null
R1644:Bdp1 UTSW 13 100060940 missense probably benign 0.03
R1670:Bdp1 UTSW 13 100027433 critical splice donor site probably null
R1836:Bdp1 UTSW 13 100035145 missense probably benign
R1869:Bdp1 UTSW 13 100042201 missense probably damaging 0.99
R1920:Bdp1 UTSW 13 100098589 missense probably benign 0.30
R1944:Bdp1 UTSW 13 100074381 splice site probably null
R2030:Bdp1 UTSW 13 100061189 missense probably benign 0.00
R2069:Bdp1 UTSW 13 100050988 missense probably benign 0.00
R2180:Bdp1 UTSW 13 100061405 small insertion probably benign
R2263:Bdp1 UTSW 13 100066037 missense probably damaging 0.96
R2277:Bdp1 UTSW 13 100061330 missense probably benign 0.05
R2277:Bdp1 UTSW 13 100061339 missense probably damaging 1.00
R2278:Bdp1 UTSW 13 100061330 missense probably benign 0.05
R2278:Bdp1 UTSW 13 100061339 missense probably damaging 1.00
R2336:Bdp1 UTSW 13 100053002 missense probably damaging 0.99
R2380:Bdp1 UTSW 13 100060370 missense probably benign 0.08
R3154:Bdp1 UTSW 13 100049814 missense probably damaging 1.00
R4212:Bdp1 UTSW 13 100059585 missense probably benign
R4322:Bdp1 UTSW 13 100092223 missense probably damaging 0.97
R4414:Bdp1 UTSW 13 100030861 missense probably damaging 0.99
R4415:Bdp1 UTSW 13 100030861 missense probably damaging 0.99
R4764:Bdp1 UTSW 13 100056267 missense probably damaging 0.99
R4766:Bdp1 UTSW 13 100049868 missense probably damaging 0.96
R4888:Bdp1 UTSW 13 100051119 missense probably benign 0.26
R4914:Bdp1 UTSW 13 100056336 missense probably benign 0.28
R4917:Bdp1 UTSW 13 100055205 missense probably damaging 0.99
R4918:Bdp1 UTSW 13 100055205 missense probably damaging 0.99
R5170:Bdp1 UTSW 13 100030794 nonsense probably null
R5266:Bdp1 UTSW 13 100067535 missense probably benign 0.33
R5312:Bdp1 UTSW 13 100097601 splice site probably null
R5420:Bdp1 UTSW 13 100066043 missense possibly damaging 0.88
R5486:Bdp1 UTSW 13 100098510 missense probably damaging 1.00
R5909:Bdp1 UTSW 13 100092286 missense probably benign 0.08
R5913:Bdp1 UTSW 13 100051104 missense probably benign 0.41
R6018:Bdp1 UTSW 13 100038224 missense probably benign 0.00
R6037:Bdp1 UTSW 13 100027449 missense possibly damaging 0.65
R6037:Bdp1 UTSW 13 100027449 missense possibly damaging 0.65
R6700:Bdp1 UTSW 13 100025528 missense probably benign 0.00
R6969:Bdp1 UTSW 13 100074531 missense probably damaging 0.97
R6972:Bdp1 UTSW 13 100037761 missense probably null 1.00
R6996:Bdp1 UTSW 13 100043813 missense probably damaging 1.00
R7043:Bdp1 UTSW 13 100078707 missense probably benign 0.03
R7060:Bdp1 UTSW 13 100059494 missense probably damaging 1.00
R7105:Bdp1 UTSW 13 100070181 missense probably damaging 1.00
R7155:Bdp1 UTSW 13 100061151 missense possibly damaging 0.93
R7175:Bdp1 UTSW 13 100049970 missense probably damaging 0.97
R7177:Bdp1 UTSW 13 100049970 missense probably damaging 0.97
R7327:Bdp1 UTSW 13 100041532 missense probably damaging 0.97
R7512:Bdp1 UTSW 13 100050949 missense probably benign 0.03
R7562:Bdp1 UTSW 13 100025541 missense probably benign 0.04
R7788:Bdp1 UTSW 13 100055251 missense possibly damaging 0.64
R7842:Bdp1 UTSW 13 100099129 missense probably damaging 1.00
R7850:Bdp1 UTSW 13 100092324 missense probably damaging 1.00
R7904:Bdp1 UTSW 13 100041436 missense probably benign 0.37
R7975:Bdp1 UTSW 13 100020376 missense probably benign 0.01
R7999:Bdp1 UTSW 13 100058896 missense possibly damaging 0.93
R8126:Bdp1 UTSW 13 100056282 missense probably damaging 1.00
R8340:Bdp1 UTSW 13 100065968 missense possibly damaging 0.61
R8414:Bdp1 UTSW 13 100064477 missense probably benign 0.03
R8468:Bdp1 UTSW 13 100060568 missense probably benign 0.04
R8688:Bdp1 UTSW 13 100103799 missense probably damaging 1.00
RF003:Bdp1 UTSW 13 100060449 missense probably benign 0.31
RF003:Bdp1 UTSW 13 100060450 missense probably benign 0.31
Z1177:Bdp1 UTSW 13 100061396 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCATTAAAGGGGTGAAAGTGCC -3'
(R):5'- TTCGAGTCGAAGAACCCCTC -3'

Sequencing Primer
(F):5'- ACACAAACTACCTCTTCCATTGTTTC -3'
(R):5'- GAGTCGAAGAACCCCTCTCTCTTC -3'
Posted On2019-10-24