Incidental Mutation 'R7583:Taf2'
ID586915
Institutional Source Beutler Lab
Gene Symbol Taf2
Ensembl Gene ENSMUSG00000037343
Gene NameTATA-box binding protein associated factor 2
SynonymsCIF150, 150kDa, TAF2B, 4732460C16Rik, TAFII150
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7583 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location55015131-55072152 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 55064676 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 110 (Y110*)
Ref Sequence ENSEMBL: ENSMUSP00000043733 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041733]
Predicted Effect probably null
Transcript: ENSMUST00000041733
AA Change: Y110*
SMART Domains Protein: ENSMUSP00000043733
Gene: ENSMUSG00000037343
AA Change: Y110*

DomainStartEndE-ValueType
Pfam:Peptidase_M1 21 406 5.6e-17 PFAM
SCOP:d1gw5a_ 606 973 6e-7 SMART
low complexity region 987 998 N/A INTRINSIC
low complexity region 1142 1175 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 99% (95/96)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Initiation of transcription by RNA polymerase II requires the activities of more than 70 polypeptides. The protein that coordinates these activities is transcription factor IID (TFIID), which binds to the core promoter to position the polymerase properly, serves as the scaffold for assembly of the remainder of the transcription complex, and acts as a channel for regulatory signals. TFIID is composed of the TATA-binding protein (TBP) and a group of evolutionarily conserved proteins known as TBP-associated factors or TAFs. TAFs may participate in basal transcription, serve as coactivators, function in promoter recognition or modify general transcription factors (GTFs) to facilitate complex assembly and transcription initiation. This gene encodes one of the larger subunits of TFIID that is stably associated with the TFIID complex. It contributes to interactions at and downstream of the transcription initiation site, interactions that help determine transcription complex response to activators. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 98 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik A T 2: 68,739,326 D462V probably damaging Het
Abcc1 T C 16: 14,404,038 W222R probably damaging Het
Adamts13 A G 2: 26,973,953 K48E probably benign Het
Adgrd1 A C 5: 129,179,588 T674P probably benign Het
Agbl4 A T 4: 111,118,953 Y169F possibly damaging Het
Ahnak T A 19: 9,006,093 N1580K possibly damaging Het
Angptl8 A C 9: 21,835,914 probably null Het
Ap3d1 G A 10: 80,709,458 T1053I probably benign Het
Atad2 T C 15: 58,126,664 T139A probably benign Het
Bdp1 T A 13: 100,049,812 T1711S probably damaging Het
Bod1l T C 5: 41,833,790 I141V probably damaging Het
Cavin2 A T 1: 51,289,618 N78I possibly damaging Het
Ccnb1 T C 13: 100,779,754 H406R probably benign Het
Cd200r4 A G 16: 44,833,421 T194A probably damaging Het
Cdt1 G A 8: 122,570,256 R263H probably damaging Het
Cep85l A T 10: 53,281,354 I751N probably damaging Het
Clasp2 A G 9: 113,908,687 D1043G probably benign Het
Cmip A T 8: 117,454,952 N578I probably damaging Het
Col2a1 T G 15: 97,976,184 K1440N unknown Het
Cpne2 A T 8: 94,555,581 M252L probably benign Het
Crb2 A G 2: 37,790,595 T512A probably benign Het
Csmd1 A G 8: 15,998,833 Y2290H probably damaging Het
Ctnnd1 A T 2: 84,612,061 D642E probably damaging Het
Ctns A G 11: 73,188,470 S141P probably benign Het
Cwh43 A G 5: 73,434,289 Q575R probably benign Het
Cyp2b19 C A 7: 26,759,064 T68K probably damaging Het
Dcaf6 A G 1: 165,333,310 S849P probably damaging Het
Dnm3 T A 1: 162,477,774 Q17L possibly damaging Het
Enpp3 A T 10: 24,836,092 M1K probably null Het
Fam124a T A 14: 62,606,559 C505* probably null Het
Fam160b1 T A 19: 57,378,602 D192E probably benign Het
Fsip2 A G 2: 82,975,241 I635V probably benign Het
Gm5878 A T 6: 85,118,700 probably null Het
Gm6205 A T 5: 94,682,894 T84S possibly damaging Het
Gpld1 C A 13: 24,975,760 A437D probably damaging Het
Grk5 G T 19: 61,083,204 V401L possibly damaging Het
Gucy2g A T 19: 55,235,615 L259Q probably damaging Het
Habp2 T A 19: 56,311,804 D191E probably benign Het
Helz2 T A 2: 181,237,572 H751L probably benign Het
Hgsnat A G 8: 25,971,564 probably null Het
Hivep1 T A 13: 42,164,240 V2064E probably damaging Het
Ikbke C T 1: 131,276,479 A26T probably damaging Het
Ivd C A 2: 118,862,131 D37E probably damaging Het
Kif26b G A 1: 178,530,445 W40* probably null Het
Klrc2 A G 6: 129,659,311 S114P probably damaging Het
Lama1 A T 17: 67,761,621 T772S Het
Lamc1 T A 1: 153,243,232 K880N possibly damaging Het
Lmf1 G A 17: 25,655,449 D12N Het
Lpin2 G T 17: 71,231,396 E384* probably null Het
Lrrc23 T C 6: 124,779,578 probably benign Het
Lrrc31 T C 3: 30,691,099 probably null Het
Luc7l2 A G 6: 38,551,885 Q13R probably damaging Het
Ly6c1 G T 15: 75,048,497 H5Q probably damaging Het
Lyst A T 13: 13,635,887 H714L probably damaging Het
Man2a2 C T 7: 80,366,944 R374H probably damaging Het
Mchr1 A T 15: 81,237,441 T131S probably benign Het
Msto1 T C 3: 88,912,929 probably null Het
Myh1 C T 11: 67,220,913 T1698I probably benign Het
Ncapd3 G T 9: 27,071,848 C964F probably damaging Het
Nefh T C 11: 4,941,089 E510G probably damaging Het
Olfr1246 A T 2: 89,590,751 Y121* probably null Het
Olfr1513 T C 14: 52,349,903 T48A possibly damaging Het
Olfr357 A C 2: 36,997,080 K90T probably damaging Het
Olfr362 A T 2: 37,105,527 L41* probably null Het
Olfr538 A G 7: 140,574,210 E19G probably benign Het
P4ha1 T A 10: 59,369,640 S497R probably benign Het
Palb2 T C 7: 122,127,342 D435G probably benign Het
Papola C T 12: 105,811,045 P282L probably damaging Het
Pcdhgb1 A G 18: 37,682,324 R623G probably damaging Het
Pcolce T G 5: 137,607,445 K229Q probably benign Het
Pkhd1l1 T C 15: 44,568,364 probably null Het
Ppp6r3 T A 19: 3,490,790 T443S probably benign Het
Psg20 T A 7: 18,682,483 D236V probably damaging Het
Ptgr2 T G 12: 84,308,405 S304R probably damaging Het
Ptpn22 A T 3: 103,902,114 D681V probably benign Het
Rab3gap1 T C 1: 127,930,875 S574P probably benign Het
Slc36a1 A G 11: 55,213,928 probably null Het
Slc9a5 A G 8: 105,363,272 S621G possibly damaging Het
Sntg1 A G 1: 8,445,025 probably null Het
Snx17 A G 5: 31,196,533 N222D possibly damaging Het
Spata19 G T 9: 27,400,433 S116I possibly damaging Het
Spn G A 7: 127,137,062 A91V probably damaging Het
Srrm3 T C 5: 135,852,281 V145A probably benign Het
St7 A T 6: 17,942,754 T575S possibly damaging Het
Tcf20 T C 15: 82,855,276 E658G possibly damaging Het
Tdrd6 G T 17: 43,624,238 A1973E probably benign Het
Tg T G 15: 66,764,418 L2237W probably damaging Het
Ticrr C A 7: 79,696,739 Y1882* probably null Het
Trim45 T A 3: 100,925,023 C191S probably damaging Het
Upf3a G A 8: 13,785,889 probably null Het
Vmn2r42 A T 7: 8,194,741 L293* probably null Het
Vmn2r62 T A 7: 42,788,042 Q339H possibly damaging Het
Wdr24 A T 17: 25,825,830 R220W probably null Het
Wdr5 T A 2: 27,518,775 S22T probably benign Het
Zfp37 G A 4: 62,192,016 probably benign Het
Zfp735 A T 11: 73,711,107 L292F possibly damaging Het
Zfp985 T A 4: 147,583,489 C271* probably null Het
Zranb1 G A 7: 132,983,896 R691Q probably benign Het
Other mutations in Taf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00331:Taf2 APN 15 55071449 critical splice acceptor site probably null
IGL00475:Taf2 APN 15 55055850 nonsense probably null
IGL00549:Taf2 APN 15 55031115 missense probably benign 0.03
IGL00839:Taf2 APN 15 55045778 nonsense probably null
IGL01089:Taf2 APN 15 55016581 missense probably benign
IGL01305:Taf2 APN 15 55048274 missense probably damaging 0.99
IGL01532:Taf2 APN 15 55049486 missense possibly damaging 0.94
IGL01903:Taf2 APN 15 55060016 missense probably benign 0.03
IGL02324:Taf2 APN 15 55028376 missense probably benign
IGL02328:Taf2 APN 15 55028376 missense probably benign
IGL02405:Taf2 APN 15 55034155 splice site probably benign
IGL02671:Taf2 APN 15 55034176 missense probably benign 0.01
IGL02832:Taf2 APN 15 55016563 missense probably benign 0.01
IGL03105:Taf2 APN 15 55045799 missense probably benign 0.26
IGL03118:Taf2 APN 15 55052163 missense probably damaging 1.00
ANU22:Taf2 UTSW 15 55048274 missense probably damaging 0.99
R0104:Taf2 UTSW 15 55038338 missense probably benign 0.02
R0104:Taf2 UTSW 15 55038338 missense probably benign 0.02
R0183:Taf2 UTSW 15 55055790 missense possibly damaging 0.89
R0326:Taf2 UTSW 15 55047460 missense probably damaging 0.97
R0362:Taf2 UTSW 15 55045929 missense probably damaging 1.00
R0423:Taf2 UTSW 15 55064682 missense probably benign 0.02
R0562:Taf2 UTSW 15 55022188 splice site probably benign
R0609:Taf2 UTSW 15 55060050 missense probably damaging 1.00
R0655:Taf2 UTSW 15 55038294 missense probably damaging 1.00
R0689:Taf2 UTSW 15 55063065 missense possibly damaging 0.60
R0743:Taf2 UTSW 15 55016461 small deletion probably benign
R0898:Taf2 UTSW 15 55060084 missense probably damaging 0.97
R0969:Taf2 UTSW 15 55031157 critical splice acceptor site probably null
R0974:Taf2 UTSW 15 55016461 small deletion probably benign
R1145:Taf2 UTSW 15 55016461 small deletion probably benign
R1145:Taf2 UTSW 15 55016461 small deletion probably benign
R1160:Taf2 UTSW 15 55071397 missense probably benign 0.01
R1376:Taf2 UTSW 15 55016461 small deletion probably benign
R1388:Taf2 UTSW 15 55036625 missense probably benign 0.00
R1416:Taf2 UTSW 15 55038410 missense possibly damaging 0.95
R1458:Taf2 UTSW 15 55059915 missense probably damaging 0.99
R1477:Taf2 UTSW 15 55062172 missense possibly damaging 0.87
R1755:Taf2 UTSW 15 55016454 missense probably damaging 1.00
R1766:Taf2 UTSW 15 55071397 missense probably benign 0.01
R2090:Taf2 UTSW 15 55016486 missense probably damaging 0.99
R2228:Taf2 UTSW 15 55064646 missense possibly damaging 0.94
R2519:Taf2 UTSW 15 55052247 missense probably benign 0.03
R4073:Taf2 UTSW 15 55052237 missense probably damaging 1.00
R4470:Taf2 UTSW 15 55058880 missense possibly damaging 0.70
R4471:Taf2 UTSW 15 55058880 missense possibly damaging 0.70
R4472:Taf2 UTSW 15 55058880 missense possibly damaging 0.70
R4716:Taf2 UTSW 15 55065968 missense probably benign 0.02
R4937:Taf2 UTSW 15 55027223 nonsense probably null
R5082:Taf2 UTSW 15 55060045 missense probably benign 0.41
R5335:Taf2 UTSW 15 55045740 missense probably benign 0.14
R5383:Taf2 UTSW 15 55049419 missense possibly damaging 0.78
R5771:Taf2 UTSW 15 55059939 missense probably benign 0.01
R5862:Taf2 UTSW 15 55048323 missense possibly damaging 0.95
R5873:Taf2 UTSW 15 55038422 missense probably benign 0.00
R5908:Taf2 UTSW 15 55072006 unclassified probably benign
R6033:Taf2 UTSW 15 55058901 missense probably damaging 1.00
R6033:Taf2 UTSW 15 55058901 missense probably damaging 1.00
R6159:Taf2 UTSW 15 55063044 missense possibly damaging 0.48
R6568:Taf2 UTSW 15 55064630 missense probably damaging 1.00
R7094:Taf2 UTSW 15 55060086 missense probably benign 0.27
R7174:Taf2 UTSW 15 55048739 missense possibly damaging 0.51
R7241:Taf2 UTSW 15 55062141 missense probably benign 0.01
R7561:Taf2 UTSW 15 55055833 missense probably benign 0.16
R7818:Taf2 UTSW 15 55065930 missense probably benign
R7905:Taf2 UTSW 15 55047432 missense possibly damaging 0.90
R7988:Taf2 UTSW 15 55047432 missense possibly damaging 0.90
R8006:Taf2 UTSW 15 55048701 missense probably damaging 1.00
R8017:Taf2 UTSW 15 55064617 missense possibly damaging 0.66
R8019:Taf2 UTSW 15 55064617 missense possibly damaging 0.66
R8119:Taf2 UTSW 15 55031130 missense probably benign 0.00
R8127:Taf2 UTSW 15 55059988 missense probably damaging 1.00
R8128:Taf2 UTSW 15 55059988 missense probably damaging 1.00
R8129:Taf2 UTSW 15 55059988 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCTTACAAAGTGGTTTTCTTGCAC -3'
(R):5'- AGTATCAGGATTGGATAACTTGGC -3'

Sequencing Primer
(F):5'- GCAATTTGTAACAGCCCATGG -3'
(R):5'- GATCTGGTAAAATGTGTGGC -3'
Posted On2019-10-24