Incidental Mutation 'R7583:Tg'
ID 586917
Institutional Source Beutler Lab
Gene Symbol Tg
Ensembl Gene ENSMUSG00000053469
Gene Name thyroglobulin
Synonyms Tgn
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.110) question?
Stock # R7583 (G1)
Quality Score 225.009
Status Validated
Chromosome 15
Chromosomal Location 66670753-66850721 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to G at 66764418 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Tryptophan at position 2237 (L2237W)
Ref Sequence ENSEMBL: ENSMUSP00000070239 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065916] [ENSMUST00000171045]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000065916
AA Change: L2237W

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000070239
Gene: ENSMUSG00000053469
AA Change: L2237W

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
TY 50 97 5.9e-16 SMART
TY 118 165 5.59e-17 SMART
Pfam:Thyroglobulin_1 174 252 4e-9 PFAM
TY 317 363 4.36e-19 SMART
low complexity region 495 504 N/A INTRINSIC
TY 617 662 3.58e-15 SMART
TY 684 730 1.47e-16 SMART
TY 880 926 1.51e-4 SMART
TY 1029 1078 1.21e-12 SMART
TY 1106 1150 7.56e-5 SMART
TY 1167 1215 7.26e-16 SMART
low complexity region 1244 1255 N/A INTRINSIC
Pfam:GCC2_GCC3 1464 1509 2.7e-16 PFAM
TY 1519 1568 9.81e-13 SMART
Pfam:COesterase 2181 2717 8.4e-140 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000171045
AA Change: L618W

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000126454
Gene: ENSMUSG00000053469
AA Change: L618W

DomainStartEndE-ValueType
internal_repeat_1 93 331 1.53e-6 PROSPERO
Pfam:COesterase 562 1098 2.1e-137 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 99% (95/96)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Thyroglobulin (Tg) is a glycoprotein homodimer produced predominantly by the thryroid gland. It acts as a substrate for the synthesis of thyroxine and triiodothyronine as well as the storage of the inactive forms of thyroid hormone and iodine. Thyroglobulin is secreted from the endoplasmic reticulum to its site of iodination, and subsequent thyroxine biosynthesis, in the follicular lumen. Mutations in this gene cause thyroid dyshormonogenesis, manifested as goiter, and are associated with moderate to severe congenital hypothyroidism. Polymorphisms in this gene are associated with susceptibility to autoimmune thyroid diseases (AITD) such as Graves disease and Hashimoto thryoiditis. [provided by RefSeq, Nov 2009]
PHENOTYPE: Mice homozygous for a spontaneous mutation exhibit enlarged thyroid gland, hypothyroidism, abnormal thyroid gland morphology, and decreased body weight. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 98 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik A T 2: 68,739,326 D462V probably damaging Het
Abcc1 T C 16: 14,404,038 W222R probably damaging Het
Adamts13 A G 2: 26,973,953 K48E probably benign Het
Adgrd1 A C 5: 129,179,588 T674P probably benign Het
Agbl4 A T 4: 111,118,953 Y169F possibly damaging Het
Ahnak T A 19: 9,006,093 N1580K possibly damaging Het
Angptl8 A C 9: 21,835,914 probably null Het
Ap3d1 G A 10: 80,709,458 T1053I probably benign Het
Atad2 T C 15: 58,126,664 T139A probably benign Het
Bdp1 T A 13: 100,049,812 T1711S probably damaging Het
Bod1l T C 5: 41,833,790 I141V probably damaging Het
Cavin2 A T 1: 51,289,618 N78I possibly damaging Het
Ccnb1 T C 13: 100,779,754 H406R probably benign Het
Cd200r4 A G 16: 44,833,421 T194A probably damaging Het
Cdt1 G A 8: 122,570,256 R263H probably damaging Het
Cep85l A T 10: 53,281,354 I751N probably damaging Het
Clasp2 A G 9: 113,908,687 D1043G probably benign Het
Cmip A T 8: 117,454,952 N578I probably damaging Het
Col2a1 T G 15: 97,976,184 K1440N unknown Het
Cpne2 A T 8: 94,555,581 M252L probably benign Het
Crb2 A G 2: 37,790,595 T512A probably benign Het
Csmd1 A G 8: 15,998,833 Y2290H probably damaging Het
Ctnnd1 A T 2: 84,612,061 D642E probably damaging Het
Ctns A G 11: 73,188,470 S141P probably benign Het
Cwh43 A G 5: 73,434,289 Q575R probably benign Het
Cyp2b19 C A 7: 26,759,064 T68K probably damaging Het
Dcaf6 A G 1: 165,333,310 S849P probably damaging Het
Dnm3 T A 1: 162,477,774 Q17L possibly damaging Het
Enpp3 A T 10: 24,836,092 M1K probably null Het
Fam124a T A 14: 62,606,559 C505* probably null Het
Fam160b1 T A 19: 57,378,602 D192E probably benign Het
Fsip2 A G 2: 82,975,241 I635V probably benign Het
Gm5878 A T 6: 85,118,700 probably null Het
Gm6205 A T 5: 94,682,894 T84S possibly damaging Het
Gpld1 C A 13: 24,975,760 A437D probably damaging Het
Grk5 G T 19: 61,083,204 V401L possibly damaging Het
Gucy2g A T 19: 55,235,615 L259Q probably damaging Het
Habp2 T A 19: 56,311,804 D191E probably benign Het
Helz2 T A 2: 181,237,572 H751L probably benign Het
Hgsnat A G 8: 25,971,564 probably null Het
Hivep1 T A 13: 42,164,240 V2064E probably damaging Het
Ikbke C T 1: 131,276,479 A26T probably damaging Het
Ivd C A 2: 118,862,131 D37E probably damaging Het
Kif26b G A 1: 178,530,445 W40* probably null Het
Klrc2 A G 6: 129,659,311 S114P probably damaging Het
Lama1 A T 17: 67,761,621 T772S Het
Lamc1 T A 1: 153,243,232 K880N possibly damaging Het
Lmf1 G A 17: 25,655,449 D12N Het
Lpin2 G T 17: 71,231,396 E384* probably null Het
Lrrc23 T C 6: 124,779,578 probably benign Het
Lrrc31 T C 3: 30,691,099 probably null Het
Luc7l2 A G 6: 38,551,885 Q13R probably damaging Het
Ly6c1 G T 15: 75,048,497 H5Q probably damaging Het
Lyst A T 13: 13,635,887 H714L probably damaging Het
Man2a2 C T 7: 80,366,944 R374H probably damaging Het
Mchr1 A T 15: 81,237,441 T131S probably benign Het
Msto1 T C 3: 88,912,929 probably null Het
Myh1 C T 11: 67,220,913 T1698I probably benign Het
Ncapd3 G T 9: 27,071,848 C964F probably damaging Het
Nefh T C 11: 4,941,089 E510G probably damaging Het
Olfr1246 A T 2: 89,590,751 Y121* probably null Het
Olfr1513 T C 14: 52,349,903 T48A possibly damaging Het
Olfr357 A C 2: 36,997,080 K90T probably damaging Het
Olfr362 A T 2: 37,105,527 L41* probably null Het
Olfr538 A G 7: 140,574,210 E19G probably benign Het
P4ha1 T A 10: 59,369,640 S497R probably benign Het
Palb2 T C 7: 122,127,342 D435G probably benign Het
Papola C T 12: 105,811,045 P282L probably damaging Het
Pcdhgb1 A G 18: 37,682,324 R623G probably damaging Het
Pcolce T G 5: 137,607,445 K229Q probably benign Het
Pkhd1l1 T C 15: 44,568,364 probably null Het
Ppp6r3 T A 19: 3,490,790 T443S probably benign Het
Psg20 T A 7: 18,682,483 D236V probably damaging Het
Ptgr2 T G 12: 84,308,405 S304R probably damaging Het
Ptpn22 A T 3: 103,902,114 D681V probably benign Het
Rab3gap1 T C 1: 127,930,875 S574P probably benign Het
Slc36a1 A G 11: 55,213,928 probably null Het
Slc9a5 A G 8: 105,363,272 S621G possibly damaging Het
Sntg1 A G 1: 8,445,025 probably null Het
Snx17 A G 5: 31,196,533 N222D possibly damaging Het
Spata19 G T 9: 27,400,433 S116I possibly damaging Het
Spn G A 7: 127,137,062 A91V probably damaging Het
Srrm3 T C 5: 135,852,281 V145A probably benign Het
St7 A T 6: 17,942,754 T575S possibly damaging Het
Taf2 A T 15: 55,064,676 Y110* probably null Het
Tcf20 T C 15: 82,855,276 E658G possibly damaging Het
Tdrd6 G T 17: 43,624,238 A1973E probably benign Het
Ticrr C A 7: 79,696,739 Y1882* probably null Het
Trim45 T A 3: 100,925,023 C191S probably damaging Het
Upf3a G A 8: 13,785,889 probably null Het
Vmn2r42 A T 7: 8,194,741 L293* probably null Het
Vmn2r62 T A 7: 42,788,042 Q339H possibly damaging Het
Wdr24 A T 17: 25,825,830 R220W probably null Het
Wdr5 T A 2: 27,518,775 S22T probably benign Het
Zfp37 G A 4: 62,192,016 probably benign Het
Zfp735 A T 11: 73,711,107 L292F possibly damaging Het
Zfp985 T A 4: 147,583,489 C271* probably null Het
Zranb1 G A 7: 132,983,896 R691Q probably benign Het
Other mutations in Tg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00157:Tg APN 15 66847166 missense probably damaging 1.00
IGL00230:Tg APN 15 66827290 missense probably benign 0.00
IGL00324:Tg APN 15 66693424 missense probably benign
IGL00428:Tg APN 15 66773424 missense probably benign 0.33
IGL00703:Tg APN 15 66696489 missense probably benign 0.34
IGL00808:Tg APN 15 66683813 missense probably damaging 1.00
IGL00833:Tg APN 15 66688801 missense probably benign 0.34
IGL00899:Tg APN 15 66674073 critical splice donor site probably null
IGL00921:Tg APN 15 66764453 missense probably benign 0.28
IGL00975:Tg APN 15 66681882 missense probably benign
IGL01288:Tg APN 15 66736276 missense possibly damaging 0.81
IGL01397:Tg APN 15 66696092 splice site probably benign
IGL01634:Tg APN 15 66729566 missense probably benign 0.34
IGL01646:Tg APN 15 66678087 missense probably damaging 1.00
IGL01704:Tg APN 15 66671351 missense probably damaging 0.98
IGL01958:Tg APN 15 66759486 missense probably benign 0.06
IGL02093:Tg APN 15 66692374 missense possibly damaging 0.83
IGL02113:Tg APN 15 66705330 missense probably benign 0.08
IGL02138:Tg APN 15 66717233 missense probably benign 0.01
IGL02156:Tg APN 15 66705348 missense probably benign 0.19
IGL02169:Tg APN 15 66757943 missense probably benign 0.04
IGL02342:Tg APN 15 66764291 missense probably benign
IGL02434:Tg APN 15 66764342 missense probably damaging 0.97
IGL02506:Tg APN 15 66741594 missense possibly damaging 0.71
IGL02513:Tg APN 15 66705274 missense probably benign
IGL02549:Tg APN 15 66839361 missense probably damaging 1.00
IGL02669:Tg APN 15 66748726 splice site probably benign
IGL02756:Tg APN 15 66734586 missense probably benign
IGL02800:Tg APN 15 66757886 missense probably damaging 1.00
IGL02828:Tg APN 15 66682394 missense probably damaging 1.00
IGL02927:Tg APN 15 66678093 missense probably damaging 1.00
IGL03061:Tg APN 15 66671405 missense probably damaging 1.00
IGL03105:Tg APN 15 66715106 missense probably benign 0.01
IGL03160:Tg APN 15 66839303 nonsense probably null
IGL03242:Tg APN 15 66683798 missense probably damaging 0.99
Also_ran UTSW 15 66678839 missense probably damaging 1.00
bedraggled UTSW 15 66740714 missense probably damaging 1.00
foster UTSW 15 66693260 nonsense probably null
hognose UTSW 15 66717208 missense probably damaging 0.99
ito UTSW 15 66766162 nonsense probably null
ito2 UTSW 15 66671396 missense probably damaging 1.00
ito3 UTSW 15 66773474 missense probably damaging 1.00
ito4 UTSW 15 66696520 missense possibly damaging 0.47
Papua UTSW 15 66674050 missense probably damaging 1.00
Pipistrella UTSW 15 66696135 missense probably damaging 1.00
pluribus UTSW 15 66715163 missense probably damaging 0.98
samarai UTSW 15 66758006 critical splice donor site probably null
sariba UTSW 15 66694870 missense probably benign 0.01
ticker UTSW 15 66827382 nonsense probably null
Vampire UTSW 15 66682827 missense probably damaging 1.00
IGL03134:Tg UTSW 15 66740718 missense probably damaging 1.00
P0019:Tg UTSW 15 66688863 missense probably benign 0.01
R0121:Tg UTSW 15 66740781 missense probably benign 0.04
R0135:Tg UTSW 15 66694870 missense probably benign 0.01
R0227:Tg UTSW 15 66698446 missense possibly damaging 0.84
R0448:Tg UTSW 15 66764442 missense probably damaging 1.00
R0453:Tg UTSW 15 66828533 missense probably benign 0.09
R0504:Tg UTSW 15 66682404 missense probably damaging 0.97
R0543:Tg UTSW 15 66729597 missense probably benign 0.13
R0638:Tg UTSW 15 66717208 missense probably damaging 0.99
R0639:Tg UTSW 15 66741484 critical splice acceptor site probably null
R0646:Tg UTSW 15 66729626 missense probably damaging 0.99
R0666:Tg UTSW 15 66737521 missense probably benign
R0673:Tg UTSW 15 66741484 critical splice acceptor site probably null
R0689:Tg UTSW 15 66839404 splice site probably benign
R0704:Tg UTSW 15 66757880 missense probably benign 0.02
R0730:Tg UTSW 15 66678789 missense probably damaging 1.00
R0830:Tg UTSW 15 66725144 missense probably damaging 1.00
R0959:Tg UTSW 15 66708010 missense probably damaging 0.98
R1027:Tg UTSW 15 66672409 missense possibly damaging 0.65
R1061:Tg UTSW 15 66698559 missense probably benign 0.09
R1086:Tg UTSW 15 66684062 missense probably benign
R1103:Tg UTSW 15 66719655 missense probably benign 0.45
R1240:Tg UTSW 15 66828548 missense probably benign 0.16
R1281:Tg UTSW 15 66696489 missense probably benign 0.34
R1470:Tg UTSW 15 66849463 missense possibly damaging 0.95
R1470:Tg UTSW 15 66849463 missense possibly damaging 0.95
R1531:Tg UTSW 15 66850502 missense probably benign 0.02
R1544:Tg UTSW 15 66705232 missense probably benign 0.04
R1550:Tg UTSW 15 66693430 missense possibly damaging 0.52
R1575:Tg UTSW 15 66729685 critical splice donor site probably null
R1638:Tg UTSW 15 66696166 nonsense probably null
R1655:Tg UTSW 15 66828568 critical splice donor site probably null
R1671:Tg UTSW 15 66692387 missense possibly damaging 0.89
R1789:Tg UTSW 15 66737548 missense probably benign 0.00
R1883:Tg UTSW 15 66671309 missense probably damaging 1.00
R1984:Tg UTSW 15 66682842 missense probably benign
R2063:Tg UTSW 15 66828553 missense probably damaging 1.00
R2092:Tg UTSW 15 66849607 missense probably null 0.26
R2109:Tg UTSW 15 66729594 missense probably benign 0.02
R2128:Tg UTSW 15 66694894 missense probably benign 0.10
R2129:Tg UTSW 15 66694894 missense probably benign 0.10
R2207:Tg UTSW 15 66681939 missense probably benign 0.15
R2219:Tg UTSW 15 66681933 missense probably benign 0.03
R2228:Tg UTSW 15 66674011 missense probably damaging 0.99
R2229:Tg UTSW 15 66674011 missense probably damaging 0.99
R2259:Tg UTSW 15 66683898 missense probably benign
R2994:Tg UTSW 15 66681953 missense probably benign
R3904:Tg UTSW 15 66766162 nonsense probably null
R3946:Tg UTSW 15 66674023 missense probably damaging 1.00
R3965:Tg UTSW 15 66684190 missense probably benign
R4245:Tg UTSW 15 66696469 missense possibly damaging 0.68
R4451:Tg UTSW 15 66766147 missense probably benign 0.01
R4487:Tg UTSW 15 66671396 missense probably damaging 1.00
R4489:Tg UTSW 15 66707942 missense probably damaging 1.00
R4623:Tg UTSW 15 66735271 missense probably benign 0.23
R4659:Tg UTSW 15 66673920 missense possibly damaging 0.67
R4728:Tg UTSW 15 66682827 missense probably damaging 1.00
R4760:Tg UTSW 15 66693319 missense probably damaging 1.00
R4797:Tg UTSW 15 66758006 critical splice donor site probably null
R4944:Tg UTSW 15 66764337 missense probably damaging 1.00
R4998:Tg UTSW 15 66674050 missense probably damaging 1.00
R5009:Tg UTSW 15 66696586 missense probably benign 0.01
R5025:Tg UTSW 15 66707930 missense probably damaging 1.00
R5035:Tg UTSW 15 66681813 splice site probably null
R5049:Tg UTSW 15 66827382 nonsense probably null
R5073:Tg UTSW 15 66735252 missense probably benign 0.05
R5169:Tg UTSW 15 66678780 nonsense probably null
R5185:Tg UTSW 15 66773474 missense probably damaging 1.00
R5227:Tg UTSW 15 66759567 missense possibly damaging 0.87
R5300:Tg UTSW 15 66678855 missense probably damaging 1.00
R5334:Tg UTSW 15 66678055 missense probably damaging 1.00
R5339:Tg UTSW 15 66678093 missense probably damaging 1.00
R5402:Tg UTSW 15 66739168 missense probably damaging 0.98
R5441:Tg UTSW 15 66696520 missense possibly damaging 0.47
R5509:Tg UTSW 15 66827293 missense probably benign 0.45
R5580:Tg UTSW 15 66685300 missense possibly damaging 0.66
R5582:Tg UTSW 15 66693435 missense probably damaging 1.00
R5624:Tg UTSW 15 66838057 missense probably benign 0.11
R5686:Tg UTSW 15 66688889 missense probably benign 0.28
R6042:Tg UTSW 15 66683993 missense probably benign 0.01
R6122:Tg UTSW 15 66828457 missense probably damaging 1.00
R6146:Tg UTSW 15 66673367 splice site probably null
R6159:Tg UTSW 15 66735247 missense possibly damaging 0.71
R6223:Tg UTSW 15 66707922 missense probably benign 0.15
R6480:Tg UTSW 15 66671311 missense probably damaging 1.00
R6505:Tg UTSW 15 66759558 missense probably damaging 0.99
R6531:Tg UTSW 15 66839362 missense probably damaging 0.99
R6614:Tg UTSW 15 66735259 missense probably damaging 0.99
R6698:Tg UTSW 15 66839362 missense probably damaging 1.00
R6798:Tg UTSW 15 66678839 missense probably damaging 1.00
R6837:Tg UTSW 15 66696135 missense probably damaging 1.00
R6861:Tg UTSW 15 66688891 missense probably benign 0.00
R6888:Tg UTSW 15 66696246 missense probably damaging 0.99
R6933:Tg UTSW 15 66764309 missense possibly damaging 0.73
R6983:Tg UTSW 15 66693358 missense probably benign 0.01
R7078:Tg UTSW 15 66673543 missense probably damaging 1.00
R7244:Tg UTSW 15 66740714 missense probably damaging 1.00
R7320:Tg UTSW 15 66694784 missense possibly damaging 0.71
R7334:Tg UTSW 15 66725272 missense probably benign 0.01
R7418:Tg UTSW 15 66696583 missense probably damaging 0.99
R7485:Tg UTSW 15 66696588 missense probably benign 0.04
R7524:Tg UTSW 15 66696161 missense probably benign 0.01
R7529:Tg UTSW 15 66694768 missense probably damaging 0.99
R7540:Tg UTSW 15 66689927 missense probably benign 0.16
R7594:Tg UTSW 15 66729583 missense probably benign 0.20
R7667:Tg UTSW 15 66715163 missense probably damaging 0.98
R7722:Tg UTSW 15 66764309 missense possibly damaging 0.73
R7790:Tg UTSW 15 66849604 missense probably damaging 0.99
R7838:Tg UTSW 15 66693263 missense probably benign 0.00
R7890:Tg UTSW 15 66683814 missense probably damaging 1.00
R7904:Tg UTSW 15 66705279 missense probably benign 0.08
R7919:Tg UTSW 15 66684074 missense possibly damaging 0.73
R7921:Tg UTSW 15 66683793 missense probably benign 0.08
R8037:Tg UTSW 15 66688875 missense probably benign 0.00
R8038:Tg UTSW 15 66688875 missense probably benign 0.00
R8214:Tg UTSW 15 66773398 missense probably damaging 1.00
R8304:Tg UTSW 15 66693260 nonsense probably null
R8688:Tg UTSW 15 66694953 critical splice donor site probably benign
R8709:Tg UTSW 15 66681937 missense probably benign 0.08
R8714:Tg UTSW 15 66684042 missense probably damaging 0.97
R8901:Tg UTSW 15 66685335 missense probably damaging 1.00
R8917:Tg UTSW 15 66773483 critical splice donor site probably null
R9023:Tg UTSW 15 66683673 missense probably damaging 1.00
R9232:Tg UTSW 15 66698461 missense probably benign 0.01
R9310:Tg UTSW 15 66827269 missense possibly damaging 0.69
R9361:Tg UTSW 15 66685397 missense possibly damaging 0.50
R9389:Tg UTSW 15 66689324 missense probably benign 0.04
R9501:Tg UTSW 15 66847074 missense possibly damaging 0.52
R9510:Tg UTSW 15 66674064 missense probably damaging 1.00
R9594:Tg UTSW 15 66735260 nonsense probably null
R9629:Tg UTSW 15 66683738 missense possibly damaging 0.95
R9701:Tg UTSW 15 66766142 missense probably benign 0.03
R9743:Tg UTSW 15 66689990 missense probably benign 0.18
R9748:Tg UTSW 15 66847159 missense possibly damaging 0.91
T0975:Tg UTSW 15 66688863 missense probably benign 0.01
X0005:Tg UTSW 15 66688863 missense probably benign 0.01
X0065:Tg UTSW 15 66682454 missense probably damaging 1.00
X0067:Tg UTSW 15 66748743 missense probably benign 0.10
Z1177:Tg UTSW 15 66685310 missense possibly damaging 0.49
Z1177:Tg UTSW 15 66849547 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- GAATGCAAGTTCTTACTGTCTGTCC -3'
(R):5'- ACTGGGCACATGTATCACCC -3'

Sequencing Primer
(F):5'- AAGTTCTTACTGTCTGTCCACCCC -3'
(R):5'- TTCAAAAAAATGGTGCCG -3'
Posted On 2019-10-24