Incidental Mutation 'R7583:Abcc1'
ID586922
Institutional Source Beutler Lab
Gene Symbol Abcc1
Ensembl Gene ENSMUSG00000023088
Gene NameATP-binding cassette, sub-family C (CFTR/MRP), member 1
SynonymsMrp1, Mdrap, MRP, Abcc1b, Abcc1a
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.093) question?
Stock #R7583 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location14361558-14475737 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 14404038 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 222 (W222R)
Ref Sequence ENSEMBL: ENSMUSP00000097743 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100167] [ENSMUST00000130671] [ENSMUST00000133454] [ENSMUST00000134776] [ENSMUST00000147759]
Predicted Effect probably damaging
Transcript: ENSMUST00000100167
AA Change: W222R

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000097743
Gene: ENSMUSG00000023088
AA Change: W222R

DomainStartEndE-ValueType
transmembrane domain 38 57 N/A INTRINSIC
transmembrane domain 77 94 N/A INTRINSIC
transmembrane domain 104 126 N/A INTRINSIC
transmembrane domain 139 161 N/A INTRINSIC
transmembrane domain 176 198 N/A INTRINSIC
low complexity region 279 290 N/A INTRINSIC
Pfam:ABC_membrane 326 597 7.8e-44 PFAM
AAA 670 845 4.07e-8 SMART
Pfam:ABC_membrane 971 1243 3e-52 PFAM
AAA 1316 1501 5.8e-13 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000130671
AA Change: W222R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000116714
Gene: ENSMUSG00000023088
AA Change: W222R

DomainStartEndE-ValueType
transmembrane domain 38 57 N/A INTRINSIC
transmembrane domain 77 94 N/A INTRINSIC
transmembrane domain 104 126 N/A INTRINSIC
transmembrane domain 139 161 N/A INTRINSIC
transmembrane domain 176 198 N/A INTRINSIC
low complexity region 279 290 N/A INTRINSIC
Pfam:ABC_membrane 326 597 1.6e-48 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000133454
AA Change: W222R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000122656
Gene: ENSMUSG00000023088
AA Change: W222R

DomainStartEndE-ValueType
transmembrane domain 38 57 N/A INTRINSIC
transmembrane domain 77 94 N/A INTRINSIC
transmembrane domain 104 126 N/A INTRINSIC
transmembrane domain 139 161 N/A INTRINSIC
transmembrane domain 176 198 N/A INTRINSIC
low complexity region 279 290 N/A INTRINSIC
Pfam:ABC_membrane 326 597 1.6e-48 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000134776
AA Change: W180R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000120933
Gene: ENSMUSG00000023088
AA Change: W180R

DomainStartEndE-ValueType
transmembrane domain 38 57 N/A INTRINSIC
transmembrane domain 77 94 N/A INTRINSIC
transmembrane domain 104 126 N/A INTRINSIC
transmembrane domain 131 153 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000147759
AA Change: W222R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000115627
Gene: ENSMUSG00000023088
AA Change: W222R

DomainStartEndE-ValueType
transmembrane domain 38 57 N/A INTRINSIC
transmembrane domain 77 94 N/A INTRINSIC
transmembrane domain 104 126 N/A INTRINSIC
transmembrane domain 139 161 N/A INTRINSIC
transmembrane domain 176 198 N/A INTRINSIC
low complexity region 279 290 N/A INTRINSIC
Pfam:ABC_membrane 326 597 1.6e-48 PFAM
Meta Mutation Damage Score 0.9142 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 99% (95/96)
MGI Phenotype FUNCTION: The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This full transporter is a member of the MRP subfamily which is involved in multi-drug resistance. This protein plays an essential role in the defense against toxic compounds and serves as the major high-affinity transporter of leukotriene C4. The encoded protein may also play an essential role in steroid hormone homeostasis as a transporter for steroid hormones and their metabolites. [provided by RefSeq, Nov 2011]
PHENOTYPE: Mice homozygous for targeted mutations that inactivate the gene have a reduced response to inflammatory stimulus, increased levels of glutathione due to impaired metabolism, and are hypersensitive to the anticancer drug etoposide. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 98 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik A T 2: 68,739,326 D462V probably damaging Het
Adamts13 A G 2: 26,973,953 K48E probably benign Het
Adgrd1 A C 5: 129,179,588 T674P probably benign Het
Agbl4 A T 4: 111,118,953 Y169F possibly damaging Het
Ahnak T A 19: 9,006,093 N1580K possibly damaging Het
Angptl8 A C 9: 21,835,914 probably null Het
Ap3d1 G A 10: 80,709,458 T1053I probably benign Het
Atad2 T C 15: 58,126,664 T139A probably benign Het
Bdp1 T A 13: 100,049,812 T1711S probably damaging Het
Bod1l T C 5: 41,833,790 I141V probably damaging Het
Cavin2 A T 1: 51,289,618 N78I possibly damaging Het
Ccnb1 T C 13: 100,779,754 H406R probably benign Het
Cd200r4 A G 16: 44,833,421 T194A probably damaging Het
Cdt1 G A 8: 122,570,256 R263H probably damaging Het
Cep85l A T 10: 53,281,354 I751N probably damaging Het
Clasp2 A G 9: 113,908,687 D1043G probably benign Het
Cmip A T 8: 117,454,952 N578I probably damaging Het
Col2a1 T G 15: 97,976,184 K1440N unknown Het
Cpne2 A T 8: 94,555,581 M252L probably benign Het
Crb2 A G 2: 37,790,595 T512A probably benign Het
Csmd1 A G 8: 15,998,833 Y2290H probably damaging Het
Ctnnd1 A T 2: 84,612,061 D642E probably damaging Het
Ctns A G 11: 73,188,470 S141P probably benign Het
Cwh43 A G 5: 73,434,289 Q575R probably benign Het
Cyp2b19 C A 7: 26,759,064 T68K probably damaging Het
Dcaf6 A G 1: 165,333,310 S849P probably damaging Het
Dnm3 T A 1: 162,477,774 Q17L possibly damaging Het
Enpp3 A T 10: 24,836,092 M1K probably null Het
Fam124a T A 14: 62,606,559 C505* probably null Het
Fam160b1 T A 19: 57,378,602 D192E probably benign Het
Fsip2 A G 2: 82,975,241 I635V probably benign Het
Gm5878 A T 6: 85,118,700 probably null Het
Gm6205 A T 5: 94,682,894 T84S possibly damaging Het
Gpld1 C A 13: 24,975,760 A437D probably damaging Het
Grk5 G T 19: 61,083,204 V401L possibly damaging Het
Gucy2g A T 19: 55,235,615 L259Q probably damaging Het
Habp2 T A 19: 56,311,804 D191E probably benign Het
Helz2 T A 2: 181,237,572 H751L probably benign Het
Hgsnat A G 8: 25,971,564 probably null Het
Hivep1 T A 13: 42,164,240 V2064E probably damaging Het
Ikbke C T 1: 131,276,479 A26T probably damaging Het
Ivd C A 2: 118,862,131 D37E probably damaging Het
Kif26b G A 1: 178,530,445 W40* probably null Het
Klrc2 A G 6: 129,659,311 S114P probably damaging Het
Lama1 A T 17: 67,761,621 T772S Het
Lamc1 T A 1: 153,243,232 K880N possibly damaging Het
Lmf1 G A 17: 25,655,449 D12N Het
Lpin2 G T 17: 71,231,396 E384* probably null Het
Lrrc23 T C 6: 124,779,578 probably benign Het
Lrrc31 T C 3: 30,691,099 probably null Het
Luc7l2 A G 6: 38,551,885 Q13R probably damaging Het
Ly6c1 G T 15: 75,048,497 H5Q probably damaging Het
Lyst A T 13: 13,635,887 H714L probably damaging Het
Man2a2 C T 7: 80,366,944 R374H probably damaging Het
Mchr1 A T 15: 81,237,441 T131S probably benign Het
Msto1 T C 3: 88,912,929 probably null Het
Myh1 C T 11: 67,220,913 T1698I probably benign Het
Ncapd3 G T 9: 27,071,848 C964F probably damaging Het
Nefh T C 11: 4,941,089 E510G probably damaging Het
Olfr1246 A T 2: 89,590,751 Y121* probably null Het
Olfr1513 T C 14: 52,349,903 T48A possibly damaging Het
Olfr357 A C 2: 36,997,080 K90T probably damaging Het
Olfr362 A T 2: 37,105,527 L41* probably null Het
Olfr538 A G 7: 140,574,210 E19G probably benign Het
P4ha1 T A 10: 59,369,640 S497R probably benign Het
Palb2 T C 7: 122,127,342 D435G probably benign Het
Papola C T 12: 105,811,045 P282L probably damaging Het
Pcdhgb1 A G 18: 37,682,324 R623G probably damaging Het
Pcolce T G 5: 137,607,445 K229Q probably benign Het
Pkhd1l1 T C 15: 44,568,364 probably null Het
Ppp6r3 T A 19: 3,490,790 T443S probably benign Het
Psg20 T A 7: 18,682,483 D236V probably damaging Het
Ptgr2 T G 12: 84,308,405 S304R probably damaging Het
Ptpn22 A T 3: 103,902,114 D681V probably benign Het
Rab3gap1 T C 1: 127,930,875 S574P probably benign Het
Slc36a1 A G 11: 55,213,928 probably null Het
Slc9a5 A G 8: 105,363,272 S621G possibly damaging Het
Sntg1 A G 1: 8,445,025 probably null Het
Snx17 A G 5: 31,196,533 N222D possibly damaging Het
Spata19 G T 9: 27,400,433 S116I possibly damaging Het
Spn G A 7: 127,137,062 A91V probably damaging Het
Srrm3 T C 5: 135,852,281 V145A probably benign Het
St7 A T 6: 17,942,754 T575S possibly damaging Het
Taf2 A T 15: 55,064,676 Y110* probably null Het
Tcf20 T C 15: 82,855,276 E658G possibly damaging Het
Tdrd6 G T 17: 43,624,238 A1973E probably benign Het
Tg T G 15: 66,764,418 L2237W probably damaging Het
Ticrr C A 7: 79,696,739 Y1882* probably null Het
Trim45 T A 3: 100,925,023 C191S probably damaging Het
Upf3a G A 8: 13,785,889 probably null Het
Vmn2r42 A T 7: 8,194,741 L293* probably null Het
Vmn2r62 T A 7: 42,788,042 Q339H possibly damaging Het
Wdr24 A T 17: 25,825,830 R220W probably null Het
Wdr5 T A 2: 27,518,775 S22T probably benign Het
Zfp37 G A 4: 62,192,016 probably benign Het
Zfp735 A T 11: 73,711,107 L292F possibly damaging Het
Zfp985 T A 4: 147,583,489 C271* probably null Het
Zranb1 G A 7: 132,983,896 R691Q probably benign Het
Other mutations in Abcc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Abcc1 APN 16 14460983 missense probably benign 0.34
IGL00094:Abcc1 APN 16 14470534 missense probably null 0.00
IGL00475:Abcc1 APN 16 14436573 missense probably damaging 1.00
IGL00516:Abcc1 APN 16 14413312 nonsense probably null
IGL00765:Abcc1 APN 16 14411508 missense probably damaging 0.99
IGL00792:Abcc1 APN 16 14410926 missense probably benign 0.18
IGL01678:Abcc1 APN 16 14405019 missense probably null 0.96
IGL01683:Abcc1 APN 16 14396424 missense probably damaging 1.00
IGL01955:Abcc1 APN 16 14410795 missense probably damaging 1.00
IGL02048:Abcc1 APN 16 14411519 missense probably damaging 0.98
IGL02345:Abcc1 APN 16 14396351 missense possibly damaging 0.95
IGL02366:Abcc1 APN 16 14467979 splice site probably benign
IGL02431:Abcc1 APN 16 14419734 missense probably damaging 1.00
IGL02480:Abcc1 APN 16 14404005 missense possibly damaging 0.87
IGL02651:Abcc1 APN 16 14466126 missense probably benign 0.00
IGL02902:Abcc1 APN 16 14423127 missense probably damaging 1.00
IGL03101:Abcc1 APN 16 14389868 missense probably damaging 1.00
IGL03230:Abcc1 APN 16 14457947 missense probably benign
IGL03308:Abcc1 APN 16 14470611 missense possibly damaging 0.55
PIT4544001:Abcc1 UTSW 16 14405079 missense probably damaging 1.00
R0310:Abcc1 UTSW 16 14410927 missense probably damaging 0.98
R0594:Abcc1 UTSW 16 14389880 missense probably benign 0.05
R0894:Abcc1 UTSW 16 14465137 missense possibly damaging 0.64
R0928:Abcc1 UTSW 16 14389985 critical splice donor site probably null
R1367:Abcc1 UTSW 16 14443386 missense probably damaging 1.00
R1496:Abcc1 UTSW 16 14448434 missense probably damaging 1.00
R1643:Abcc1 UTSW 16 14413368 missense probably damaging 1.00
R1795:Abcc1 UTSW 16 14465137 missense possibly damaging 0.64
R1834:Abcc1 UTSW 16 14423117 missense possibly damaging 0.88
R1847:Abcc1 UTSW 16 14445449 missense probably benign 0.02
R1959:Abcc1 UTSW 16 14396393 missense probably damaging 1.00
R1961:Abcc1 UTSW 16 14396393 missense probably damaging 1.00
R2017:Abcc1 UTSW 16 14461204 missense probably damaging 1.00
R2224:Abcc1 UTSW 16 14472068 missense probably damaging 1.00
R2377:Abcc1 UTSW 16 14467923 missense probably damaging 0.97
R2513:Abcc1 UTSW 16 14473009 splice site probably null
R2876:Abcc1 UTSW 16 14457960 missense probably benign
R3003:Abcc1 UTSW 16 14436529 missense probably damaging 1.00
R3941:Abcc1 UTSW 16 14396399 missense probably benign 0.00
R4119:Abcc1 UTSW 16 14394013 missense probably benign 0.43
R4191:Abcc1 UTSW 16 14389864 missense probably damaging 1.00
R4369:Abcc1 UTSW 16 14460993 missense possibly damaging 0.88
R4428:Abcc1 UTSW 16 14445300 missense probably damaging 0.97
R4589:Abcc1 UTSW 16 14394031 missense probably benign 0.00
R4779:Abcc1 UTSW 16 14410771 missense probably benign 0.35
R5027:Abcc1 UTSW 16 14404053 critical splice donor site probably null
R5275:Abcc1 UTSW 16 14466186 missense probably damaging 1.00
R5418:Abcc1 UTSW 16 14461132 missense probably benign 0.02
R5490:Abcc1 UTSW 16 14410917 missense probably damaging 1.00
R5527:Abcc1 UTSW 16 14460978 missense probably benign 0.18
R5641:Abcc1 UTSW 16 14472013 missense probably benign 0.00
R5642:Abcc1 UTSW 16 14443455 missense probably damaging 1.00
R5875:Abcc1 UTSW 16 14467037 missense possibly damaging 0.94
R5916:Abcc1 UTSW 16 14465142 missense possibly damaging 0.95
R6112:Abcc1 UTSW 16 14460916 missense probably damaging 1.00
R6331:Abcc1 UTSW 16 14465056 missense probably damaging 0.97
R6464:Abcc1 UTSW 16 14447490 missense probably damaging 1.00
R6950:Abcc1 UTSW 16 14411616 missense probably damaging 1.00
R7024:Abcc1 UTSW 16 14413383 critical splice donor site probably null
R7115:Abcc1 UTSW 16 14437725 missense probably benign 0.11
R7187:Abcc1 UTSW 16 14466997 missense probably benign
R7298:Abcc1 UTSW 16 14396472 missense possibly damaging 0.89
R7342:Abcc1 UTSW 16 14465169 missense probably damaging 0.99
R7474:Abcc1 UTSW 16 14472986 missense possibly damaging 0.95
R7488:Abcc1 UTSW 16 14389899 nonsense probably null
R7619:Abcc1 UTSW 16 14445419 missense probably damaging 0.96
R7971:Abcc1 UTSW 16 14448579 missense probably benign
R8048:Abcc1 UTSW 16 14410844 missense probably damaging 1.00
R8138:Abcc1 UTSW 16 14472887 missense probably damaging 0.99
R8159:Abcc1 UTSW 16 14472930 missense probably damaging 0.96
R8319:Abcc1 UTSW 16 14396451 missense probably damaging 1.00
X0026:Abcc1 UTSW 16 14459902 missense possibly damaging 0.94
Z1088:Abcc1 UTSW 16 14410809 missense probably benign 0.01
Z1177:Abcc1 UTSW 16 14411493 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCATGTGGCATGCAGAAC -3'
(R):5'- GCAGAAACTAAGGGTGCTCAC -3'

Sequencing Primer
(F):5'- ACTGTGAAGATGTGGGCCATG -3'
(R):5'- GGTGCTCACAGCCTATGGATTAATC -3'
Posted On2019-10-24