Incidental Mutation 'R7584:Slc19a3'
ID586938
Institutional Source Beutler Lab
Gene Symbol Slc19a3
Ensembl Gene ENSMUSG00000038496
Gene Namesolute carrier family 19, member 3
SynonymsThTr2, A230084E24Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.184) question?
Stock #R7584 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location83012523-83038448 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 83022748 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 183 (V183M)
Ref Sequence ENSEMBL: ENSMUSP00000041683 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045560] [ENSMUST00000164473]
Predicted Effect possibly damaging
Transcript: ENSMUST00000045560
AA Change: V183M

PolyPhen 2 Score 0.790 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000041683
Gene: ENSMUSG00000038496
AA Change: V183M

DomainStartEndE-ValueType
Pfam:Folate_carrier 11 435 1.4e-178 PFAM
Pfam:MFS_1 16 416 1.6e-17 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000164473
AA Change: V183M

PolyPhen 2 Score 0.790 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000126646
Gene: ENSMUSG00000038496
AA Change: V183M

DomainStartEndE-ValueType
Pfam:Folate_carrier 11 435 1.3e-178 PFAM
Pfam:MFS_1 16 416 1.9e-17 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ubiquitously expressed transmembrane thiamine transporter that lacks folate transport activity. Mutations in this gene cause biotin-responsive basal ganglia disease (BBGD); a recessive disorder manifested in childhood that progresses to chronic encephalopathy, dystonia, quadriparesis, and death if untreated. Patients with BBGD have bilateral necrosis in the head of the caudate nucleus and in the putamen. Administration of high doses of biotin in the early progression of the disorder eliminates pathological symptoms while delayed treatment results in residual paraparesis, mild mental retardation, or dystonia. Administration of thiamine is ineffective in the treatment of this disorder. Experiments have failed to show that this protein can transport biotin. Mutations in this gene also cause a Wernicke's-like encephalopathy.[provided by RefSeq, Jan 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit premature death within a year of age, impaired thiamin uptake, lethargy, cachexia, injured liver parenchyma, hepatic necrosis, liver and kidney inflammmation, and nephrosclerosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017D01Rik A G 19: 11,110,361 F69L possibly damaging Het
1700123L14Rik A C 6: 96,165,392 L224V probably benign Het
Actrt3 T C 3: 30,598,207 K246R probably benign Het
Adam23 T A 1: 63,545,462 V343D probably damaging Het
Ak2 T C 4: 128,999,212 S55P probably damaging Het
Ank2 G A 3: 126,946,128 Q2036* probably null Het
Ano10 A G 9: 122,275,531 I40T probably benign Het
Aoc2 T A 11: 101,326,179 C363S possibly damaging Het
Aplp2 A T 9: 31,157,781 V584E possibly damaging Het
Arhgap32 A T 9: 32,256,967 T749S probably benign Het
Atm A T 9: 53,513,127 F625I probably damaging Het
Atr T C 9: 95,942,713 L2387P probably damaging Het
Barhl1 C T 2: 28,909,791 G274D probably damaging Het
Bcl2a1a A T 9: 88,957,292 D81V probably damaging Het
Ccdc63 T G 5: 122,113,204 D381A possibly damaging Het
Col12a1 A G 9: 79,703,296 probably null Het
Crat C T 2: 30,404,565 R497Q probably benign Het
Cyp4b1 T A 4: 115,628,687 D351V probably damaging Het
D130043K22Rik A G 13: 24,872,370 S562G probably damaging Het
D430042O09Rik G T 7: 125,870,666 V1436L probably damaging Het
Dmbt1 C T 7: 131,088,751 Q905* probably null Het
Dnajc21 A C 15: 10,462,295 Y81* probably null Het
Dnali1 T C 4: 125,065,538 T21A probably benign Het
Dpp8 A T 9: 65,078,782 L851F probably damaging Het
Dpt T C 1: 164,818,908 Y149H probably benign Het
Ep300 T C 15: 81,628,426 V983A unknown Het
Faf1 C T 4: 109,925,957 R549C probably damaging Het
Gcm1 A G 9: 78,064,467 N230S possibly damaging Het
Gm10803 T A 2: 93,564,168 I95N probably damaging Het
Hectd4 T A 5: 121,318,735 I721N possibly damaging Het
Hsp90ab1 T C 17: 45,570,271 H315R probably damaging Het
Igkv10-95 T A 6: 68,680,756 S85R possibly damaging Het
Kcnq5 T C 1: 21,402,321 T901A probably benign Het
Kremen1 C T 11: 5,194,964 V471M possibly damaging Het
Lama2 C A 10: 27,104,261 D1853Y possibly damaging Het
Lrif1 A G 3: 106,731,901 T76A probably benign Het
Lrrtm2 T A 18: 35,212,765 I495F possibly damaging Het
Ltbr G T 6: 125,307,241 Q413K probably benign Het
Myrfl T A 10: 116,828,997 Y376F probably damaging Het
Nup98 G T 7: 102,176,389 N414K probably benign Het
Nynrin A G 14: 55,871,584 T1383A probably damaging Het
Olfr1106 A T 2: 87,049,134 I34N probably benign Het
Olfr1211 G A 2: 88,929,805 P170L probably damaging Het
Olfr784 T A 10: 129,388,032 I133N probably damaging Het
Olfr845 C A 9: 19,339,273 T271K possibly damaging Het
Olfr915 G T 9: 38,646,895 P210T possibly damaging Het
Pcdhb5 T A 18: 37,322,372 S602T possibly damaging Het
Sall3 A G 18: 80,974,530 F61S probably benign Het
Scube1 G T 15: 83,721,887 C61* probably null Het
Sec31b T C 19: 44,543,323 D49G probably damaging Het
Skiv2l A G 17: 34,841,675 I822T possibly damaging Het
Slc41a2 T C 10: 83,316,789 probably benign Het
Sphk2 C A 7: 45,712,507 V169L probably damaging Het
Synpo C A 18: 60,596,277 R951L probably damaging Het
Tbc1d9b G A 11: 50,170,716 C1017Y probably damaging Het
Tmtc4 C A 14: 122,978,151 V28F probably benign Het
Tprkb A G 6: 85,928,827 I165V probably benign Het
Ttc23l T A 15: 10,533,708 I250F probably damaging Het
Ube3c TTCTCTC TTCTCTCTCTC 5: 29,637,629 probably benign Het
Ubr3 G A 2: 69,991,503 V1370I probably damaging Het
Ush2a A G 1: 188,728,109 probably null Het
Usp9y T C Y: 1,384,451 Y689C probably damaging Het
Vmn1r56 A T 7: 5,195,896 Y241N probably damaging Het
Vmn2r6 T C 3: 64,565,262 T13A probably benign Het
Vmn2r92 T A 17: 18,166,766 N122K probably benign Het
Vps9d1 A G 8: 123,250,717 F131S probably damaging Het
Vwa8 A C 14: 78,982,234 probably null Het
Zbtb41 T A 1: 139,424,057 Y303N probably benign Het
Zbtb5 T C 4: 44,993,678 T569A probably benign Het
Zcchc11 T C 4: 108,479,346 V89A probably benign Het
Zfp111 A G 7: 24,198,600 S530P possibly damaging Het
Other mutations in Slc19a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03066:Slc19a3 APN 1 83014836 missense probably damaging 0.99
R0437:Slc19a3 UTSW 1 83022565 missense probably benign 0.00
R0526:Slc19a3 UTSW 1 83022733 missense probably damaging 1.00
R1160:Slc19a3 UTSW 1 83022692 missense possibly damaging 0.85
R1306:Slc19a3 UTSW 1 83022762 missense probably damaging 1.00
R1832:Slc19a3 UTSW 1 83022747 missense probably damaging 0.99
R1938:Slc19a3 UTSW 1 83019368 missense possibly damaging 0.76
R1961:Slc19a3 UTSW 1 83022798 missense probably benign 0.00
R2058:Slc19a3 UTSW 1 83014791 missense probably damaging 0.98
R2200:Slc19a3 UTSW 1 83022943 missense probably damaging 0.96
R2245:Slc19a3 UTSW 1 83013970 missense possibly damaging 0.84
R2261:Slc19a3 UTSW 1 83022957 missense probably damaging 1.00
R2404:Slc19a3 UTSW 1 83023035 missense probably benign 0.16
R3891:Slc19a3 UTSW 1 83022957 missense probably damaging 1.00
R3892:Slc19a3 UTSW 1 83022957 missense probably damaging 1.00
R3907:Slc19a3 UTSW 1 83014813 missense possibly damaging 0.76
R3912:Slc19a3 UTSW 1 83022703 missense probably benign 0.09
R3922:Slc19a3 UTSW 1 83022957 missense probably damaging 1.00
R3923:Slc19a3 UTSW 1 83022957 missense probably damaging 1.00
R3961:Slc19a3 UTSW 1 83022957 missense probably damaging 1.00
R4083:Slc19a3 UTSW 1 83022957 missense probably damaging 1.00
R4106:Slc19a3 UTSW 1 83022957 missense probably damaging 1.00
R4107:Slc19a3 UTSW 1 83022957 missense probably damaging 1.00
R4109:Slc19a3 UTSW 1 83022957 missense probably damaging 1.00
R4667:Slc19a3 UTSW 1 83022799 missense probably benign
R4768:Slc19a3 UTSW 1 83023113 missense probably damaging 1.00
R4769:Slc19a3 UTSW 1 83019341 missense probably damaging 1.00
R5001:Slc19a3 UTSW 1 83022620 missense probably benign 0.33
R5538:Slc19a3 UTSW 1 83022561 missense possibly damaging 0.51
R5588:Slc19a3 UTSW 1 83023055 nonsense probably null
R6143:Slc19a3 UTSW 1 83026339 missense probably benign 0.00
R6546:Slc19a3 UTSW 1 83026360 missense probably benign 0.02
R6547:Slc19a3 UTSW 1 83022900 missense probably damaging 1.00
R7059:Slc19a3 UTSW 1 83022369 missense probably damaging 1.00
R7497:Slc19a3 UTSW 1 83013928 missense probably damaging 1.00
R7509:Slc19a3 UTSW 1 83026260 missense probably damaging 1.00
R7810:Slc19a3 UTSW 1 83019441 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- AACCAATGCGCAAAGTGTCTC -3'
(R):5'- TACATATACAGCATGGTCAGCC -3'

Sequencing Primer
(F):5'- TGCGCAAAGTGTCTCAAAGCTG -3'
(R):5'- TGGTCAGCCCAGAACACTATCAG -3'
Posted On2019-10-24