Incidental Mutation 'R7584:Actrt3'
ID586948
Institutional Source Beutler Lab
Gene Symbol Actrt3
Ensembl Gene ENSMUSG00000037737
Gene Nameactin related protein T3
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7584 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location30597073-30599939 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 30598207 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 246 (K246R)
Ref Sequence ENSEMBL: ENSMUSP00000048360 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047502] [ENSMUST00000047630] [ENSMUST00000192715] [ENSMUST00000195396] [ENSMUST00000195751]
Predicted Effect probably benign
Transcript: ENSMUST00000047502
SMART Domains Protein: ENSMUSP00000041034
Gene: ENSMUSG00000037730

DomainStartEndE-ValueType
BTB 24 119 4.44e-22 SMART
low complexity region 174 190 N/A INTRINSIC
ZnF_C2H2 302 324 1.47e-3 SMART
ZnF_C2H2 330 352 5.14e-3 SMART
ZnF_C2H2 358 380 1.36e-2 SMART
ZnF_C2H2 387 409 1.12e-3 SMART
ZnF_C2H2 415 437 3.63e-3 SMART
ZnF_C2H2 443 465 1.1e-2 SMART
ZnF_C2H2 471 493 2.99e-4 SMART
ZnF_C2H2 499 522 3.58e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000047630
AA Change: K246R

PolyPhen 2 Score 0.064 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000048360
Gene: ENSMUSG00000037737
AA Change: K246R

DomainStartEndE-ValueType
ACTIN 5 369 3.33e-147 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000192715
SMART Domains Protein: ENSMUSP00000141951
Gene: ENSMUSG00000037730

DomainStartEndE-ValueType
BTB 24 119 4.44e-22 SMART
low complexity region 174 190 N/A INTRINSIC
ZnF_C2H2 302 324 1.47e-3 SMART
ZnF_C2H2 330 352 5.14e-3 SMART
ZnF_C2H2 358 380 1.36e-2 SMART
ZnF_C2H2 387 409 1.12e-3 SMART
ZnF_C2H2 415 437 3.63e-3 SMART
ZnF_C2H2 443 465 1.1e-2 SMART
ZnF_C2H2 471 493 2.99e-4 SMART
ZnF_C2H2 499 522 3.58e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000195396
SMART Domains Protein: ENSMUSP00000141623
Gene: ENSMUSG00000037730

DomainStartEndE-ValueType
Pfam:BTB 14 55 6.4e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000195751
SMART Domains Protein: ENSMUSP00000141450
Gene: ENSMUSG00000037730

DomainStartEndE-ValueType
Pfam:BTB 14 55 6.4e-9 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 99% (74/75)
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017D01Rik A G 19: 11,110,361 F69L possibly damaging Het
1700123L14Rik A C 6: 96,165,392 L224V probably benign Het
Abcc10 A G 17: 46,315,378 probably null Het
Adam23 T A 1: 63,545,462 V343D probably damaging Het
Ak2 T C 4: 128,999,212 S55P probably damaging Het
Ank2 G A 3: 126,946,128 Q2036* probably null Het
Ano10 A G 9: 122,275,531 I40T probably benign Het
Aoc2 T A 11: 101,326,179 C363S possibly damaging Het
Aplp2 A T 9: 31,157,781 V584E possibly damaging Het
Arhgap32 A T 9: 32,256,967 T749S probably benign Het
Atm A T 9: 53,513,127 F625I probably damaging Het
Atr T C 9: 95,942,713 L2387P probably damaging Het
Barhl1 C T 2: 28,909,791 G274D probably damaging Het
Bcl2a1a A T 9: 88,957,292 D81V probably damaging Het
Ccdc63 T G 5: 122,113,204 D381A possibly damaging Het
Col12a1 A G 9: 79,703,296 probably null Het
Crat C T 2: 30,404,565 R497Q probably benign Het
Cyp4b1 T A 4: 115,628,687 D351V probably damaging Het
D130043K22Rik A G 13: 24,872,370 S562G probably damaging Het
D430042O09Rik G T 7: 125,870,666 V1436L probably damaging Het
Dgkb T A 12: 38,139,392 probably null Het
Dmbt1 C T 7: 131,088,751 Q905* probably null Het
Dnajc21 A C 15: 10,462,295 Y81* probably null Het
Dnali1 T C 4: 125,065,538 T21A probably benign Het
Dpp8 A T 9: 65,078,782 L851F probably damaging Het
Dpt T C 1: 164,818,908 Y149H probably benign Het
Ep300 T C 15: 81,628,426 V983A unknown Het
Faf1 C T 4: 109,925,957 R549C probably damaging Het
Gcm1 A G 9: 78,064,467 N230S possibly damaging Het
Gm10803 T A 2: 93,564,168 I95N probably damaging Het
Hectd4 T A 5: 121,318,735 I721N possibly damaging Het
Hsp90ab1 T C 17: 45,570,271 H315R probably damaging Het
Igkv10-95 T A 6: 68,680,756 S85R possibly damaging Het
Kcnq5 T C 1: 21,402,321 T901A probably benign Het
Kremen1 C T 11: 5,194,964 V471M possibly damaging Het
Lama2 C A 10: 27,104,261 D1853Y possibly damaging Het
Lrif1 A G 3: 106,731,901 T76A probably benign Het
Lrrtm2 T A 18: 35,212,765 I495F possibly damaging Het
Ltbr G T 6: 125,307,241 Q413K probably benign Het
Myrfl T A 10: 116,828,997 Y376F probably damaging Het
Nup98 G T 7: 102,176,389 N414K probably benign Het
Nynrin A G 14: 55,871,584 T1383A probably damaging Het
Olfr1106 A T 2: 87,049,134 I34N probably benign Het
Olfr1211 G A 2: 88,929,805 P170L probably damaging Het
Olfr784 T A 10: 129,388,032 I133N probably damaging Het
Olfr845 C A 9: 19,339,273 T271K possibly damaging Het
Olfr915 G T 9: 38,646,895 P210T possibly damaging Het
Pcdhb5 T A 18: 37,322,372 S602T possibly damaging Het
Sall3 A G 18: 80,974,530 F61S probably benign Het
Scube1 G T 15: 83,721,887 C61* probably null Het
Sec31b T C 19: 44,531,556 probably null Het
Sec31b T C 19: 44,543,323 D49G probably damaging Het
Skiv2l A G 17: 34,841,675 I822T possibly damaging Het
Slc19a3 C T 1: 83,022,748 V183M possibly damaging Het
Slc41a2 T C 10: 83,316,789 probably benign Het
Sphk2 C A 7: 45,712,507 V169L probably damaging Het
Synpo C A 18: 60,596,277 R951L probably damaging Het
Tbc1d9b G A 11: 50,170,716 C1017Y probably damaging Het
Tmtc4 C A 14: 122,978,151 V28F probably benign Het
Tprkb A G 6: 85,928,827 I165V probably benign Het
Ttc23l T A 15: 10,533,708 I250F probably damaging Het
Ubr3 G A 2: 69,991,503 V1370I probably damaging Het
Ush2a A G 1: 188,728,109 probably null Het
Usp9y T C Y: 1,384,451 Y689C probably damaging Het
Vmn1r56 A T 7: 5,195,896 Y241N probably damaging Het
Vmn2r6 T C 3: 64,565,262 T13A probably benign Het
Vmn2r92 T A 17: 18,166,766 N122K probably benign Het
Vps9d1 A G 8: 123,250,717 F131S probably damaging Het
Vwa8 A C 14: 78,982,234 probably null Het
Wfdc16 A T 2: 164,638,627 probably null Het
Zbtb41 T A 1: 139,424,057 Y303N probably benign Het
Zbtb5 T C 4: 44,993,678 T569A probably benign Het
Zcchc11 T C 4: 108,479,346 V89A probably benign Het
Zfp111 A G 7: 24,198,600 S530P possibly damaging Het
Other mutations in Actrt3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01433:Actrt3 APN 3 30598039 missense probably damaging 0.99
IGL01783:Actrt3 APN 3 30598475 missense probably benign 0.33
IGL02684:Actrt3 APN 3 30599691 missense probably benign 0.15
R0017:Actrt3 UTSW 3 30598273 missense probably benign 0.00
R0410:Actrt3 UTSW 3 30598124 missense probably benign
R0574:Actrt3 UTSW 3 30599680 missense probably benign 0.21
R1710:Actrt3 UTSW 3 30599752 missense probably damaging 1.00
R1907:Actrt3 UTSW 3 30598567 missense probably damaging 1.00
R2338:Actrt3 UTSW 3 30597836 makesense probably null
R2870:Actrt3 UTSW 3 30599698 missense probably damaging 1.00
R2870:Actrt3 UTSW 3 30599698 missense probably damaging 1.00
R4913:Actrt3 UTSW 3 30598439 missense probably benign
R5683:Actrt3 UTSW 3 30598278 missense probably benign
R5719:Actrt3 UTSW 3 30598127 missense probably benign 0.40
R5942:Actrt3 UTSW 3 30598664 missense possibly damaging 0.50
R6153:Actrt3 UTSW 3 30599750 missense probably damaging 1.00
R6177:Actrt3 UTSW 3 30598167 nonsense probably null
R6741:Actrt3 UTSW 3 30598514 missense possibly damaging 0.85
R7603:Actrt3 UTSW 3 30598547 missense probably benign
Z1177:Actrt3 UTSW 3 30598003 missense possibly damaging 0.50
Predicted Primers PCR Primer
(F):5'- TGCCACATCCTTAATGAGTCG -3'
(R):5'- GATCTGACCTCACCAGCTAC -3'

Sequencing Primer
(F):5'- TGAGTCGCTTATCTAAACCAGG -3'
(R):5'- CCAGCTACCTCATGATGTTGTTGAAG -3'
Posted On2019-10-24