Incidental Mutation 'R7584:Cyp4b1'
ID586955
Institutional Source Beutler Lab
Gene Symbol Cyp4b1
Ensembl Gene ENSMUSG00000028713
Gene Namecytochrome P450, family 4, subfamily b, polypeptide 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7584 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location115624725-115647723 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 115628687 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 351 (D351V)
Ref Sequence ENSEMBL: ENSMUSP00000099768 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102707]
Predicted Effect probably damaging
Transcript: ENSMUST00000102707
AA Change: D351V

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000099768
Gene: ENSMUSG00000028713
AA Change: D351V

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:p450 46 501 1.3e-130 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000135569
Predicted Effect
SMART Domains Protein: ENSMUSP00000118323
Gene: ENSMUSG00000028713
AA Change: D275V

DomainStartEndE-ValueType
Pfam:p450 1 375 3.5e-101 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 99% (74/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This protein localizes to the endoplasmic reticulum. In rodents, the homologous protein has been shown to metabolize certain carcinogens; however, the specific function of the human protein has not been determined. Multiple transcript variants have been found for this gene. [provided by RefSeq, Jan 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit resistance to 4-ipomeanol activation and toxicity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017D01Rik A G 19: 11,110,361 F69L possibly damaging Het
1700123L14Rik A C 6: 96,165,392 L224V probably benign Het
Abcc10 A G 17: 46,315,378 probably null Het
Actrt3 T C 3: 30,598,207 K246R probably benign Het
Adam23 T A 1: 63,545,462 V343D probably damaging Het
Ak2 T C 4: 128,999,212 S55P probably damaging Het
Ank2 G A 3: 126,946,128 Q2036* probably null Het
Ano10 A G 9: 122,275,531 I40T probably benign Het
Aoc2 T A 11: 101,326,179 C363S possibly damaging Het
Aplp2 A T 9: 31,157,781 V584E possibly damaging Het
Arhgap32 A T 9: 32,256,967 T749S probably benign Het
Atm A T 9: 53,513,127 F625I probably damaging Het
Atr T C 9: 95,942,713 L2387P probably damaging Het
Barhl1 C T 2: 28,909,791 G274D probably damaging Het
Bcl2a1a A T 9: 88,957,292 D81V probably damaging Het
Ccdc63 T G 5: 122,113,204 D381A possibly damaging Het
Col12a1 A G 9: 79,703,296 probably null Het
Crat C T 2: 30,404,565 R497Q probably benign Het
D130043K22Rik A G 13: 24,872,370 S562G probably damaging Het
D430042O09Rik G T 7: 125,870,666 V1436L probably damaging Het
Dgkb T A 12: 38,139,392 probably null Het
Dmbt1 C T 7: 131,088,751 Q905* probably null Het
Dnajc21 A C 15: 10,462,295 Y81* probably null Het
Dnali1 T C 4: 125,065,538 T21A probably benign Het
Dpp8 A T 9: 65,078,782 L851F probably damaging Het
Dpt T C 1: 164,818,908 Y149H probably benign Het
Ep300 T C 15: 81,628,426 V983A unknown Het
Faf1 C T 4: 109,925,957 R549C probably damaging Het
Gcm1 A G 9: 78,064,467 N230S possibly damaging Het
Gm10803 T A 2: 93,564,168 I95N probably damaging Het
Hectd4 T A 5: 121,318,735 I721N possibly damaging Het
Hsp90ab1 T C 17: 45,570,271 H315R probably damaging Het
Igkv10-95 T A 6: 68,680,756 S85R possibly damaging Het
Kcnq5 T C 1: 21,402,321 T901A probably benign Het
Kremen1 C T 11: 5,194,964 V471M possibly damaging Het
Lama2 C A 10: 27,104,261 D1853Y possibly damaging Het
Lrif1 A G 3: 106,731,901 T76A probably benign Het
Lrrtm2 T A 18: 35,212,765 I495F possibly damaging Het
Ltbr G T 6: 125,307,241 Q413K probably benign Het
Myrfl T A 10: 116,828,997 Y376F probably damaging Het
Nup98 G T 7: 102,176,389 N414K probably benign Het
Nynrin A G 14: 55,871,584 T1383A probably damaging Het
Olfr1106 A T 2: 87,049,134 I34N probably benign Het
Olfr1211 G A 2: 88,929,805 P170L probably damaging Het
Olfr784 T A 10: 129,388,032 I133N probably damaging Het
Olfr845 C A 9: 19,339,273 T271K possibly damaging Het
Olfr915 G T 9: 38,646,895 P210T possibly damaging Het
Pcdhb5 T A 18: 37,322,372 S602T possibly damaging Het
Sall3 A G 18: 80,974,530 F61S probably benign Het
Scube1 G T 15: 83,721,887 C61* probably null Het
Sec31b T C 19: 44,531,556 probably null Het
Sec31b T C 19: 44,543,323 D49G probably damaging Het
Skiv2l A G 17: 34,841,675 I822T possibly damaging Het
Slc19a3 C T 1: 83,022,748 V183M possibly damaging Het
Slc41a2 T C 10: 83,316,789 probably benign Het
Sphk2 C A 7: 45,712,507 V169L probably damaging Het
Synpo C A 18: 60,596,277 R951L probably damaging Het
Tbc1d9b G A 11: 50,170,716 C1017Y probably damaging Het
Tmtc4 C A 14: 122,978,151 V28F probably benign Het
Tprkb A G 6: 85,928,827 I165V probably benign Het
Ttc23l T A 15: 10,533,708 I250F probably damaging Het
Ubr3 G A 2: 69,991,503 V1370I probably damaging Het
Ush2a A G 1: 188,728,109 probably null Het
Usp9y T C Y: 1,384,451 Y689C probably damaging Het
Vmn1r56 A T 7: 5,195,896 Y241N probably damaging Het
Vmn2r6 T C 3: 64,565,262 T13A probably benign Het
Vmn2r92 T A 17: 18,166,766 N122K probably benign Het
Vps9d1 A G 8: 123,250,717 F131S probably damaging Het
Vwa8 A C 14: 78,982,234 probably null Het
Wfdc16 A T 2: 164,638,627 probably null Het
Zbtb41 T A 1: 139,424,057 Y303N probably benign Het
Zbtb5 T C 4: 44,993,678 T569A probably benign Het
Zcchc11 T C 4: 108,479,346 V89A probably benign Het
Zfp111 A G 7: 24,198,600 S530P possibly damaging Het
Other mutations in Cyp4b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01677:Cyp4b1 APN 4 115636282 missense probably damaging 0.97
IGL02484:Cyp4b1 APN 4 115647557 missense probably benign 0.00
IGL03111:Cyp4b1 APN 4 115635869 splice site probably benign
IGL03340:Cyp4b1 APN 4 115641879 missense probably damaging 1.00
R0026:Cyp4b1 UTSW 4 115647521 missense possibly damaging 0.95
R0026:Cyp4b1 UTSW 4 115647521 missense possibly damaging 0.95
R0143:Cyp4b1 UTSW 4 115635874 missense probably damaging 0.99
R0532:Cyp4b1 UTSW 4 115626876 missense probably damaging 1.00
R0725:Cyp4b1 UTSW 4 115626827 missense probably damaging 1.00
R0970:Cyp4b1 UTSW 4 115635636 missense probably benign 0.07
R1084:Cyp4b1 UTSW 4 115640312 missense probably benign 0.00
R1570:Cyp4b1 UTSW 4 115635963 missense probably benign 0.00
R1626:Cyp4b1 UTSW 4 115641658 missense probably damaging 1.00
R1966:Cyp4b1 UTSW 4 115625879 missense probably benign 0.13
R2279:Cyp4b1 UTSW 4 115640360 missense probably benign 0.23
R2396:Cyp4b1 UTSW 4 115641646 missense probably benign 0.43
R2679:Cyp4b1 UTSW 4 115628697 missense probably benign 0.01
R2885:Cyp4b1 UTSW 4 115635652 missense probably damaging 1.00
R3176:Cyp4b1 UTSW 4 115625850 missense possibly damaging 0.87
R3276:Cyp4b1 UTSW 4 115625850 missense possibly damaging 0.87
R4375:Cyp4b1 UTSW 4 115636313 missense probably benign 0.35
R7221:Cyp4b1 UTSW 4 115635978 missense possibly damaging 0.92
X0058:Cyp4b1 UTSW 4 115628778 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TTAGCCCGCAAGAAAGCTATAC -3'
(R):5'- CAGCTACTGTTGGGCATTCTTC -3'

Sequencing Primer
(F):5'- CAACAACAATAAGAAACAAATGCTGC -3'
(R):5'- GTTGGGCATTCTTCTCATCCCTAAC -3'
Posted On2019-10-24