Incidental Mutation 'R7584:Ccdc63'
ID586960
Institutional Source Beutler Lab
Gene Symbol Ccdc63
Ensembl Gene ENSMUSG00000043036
Gene Namecoiled-coil domain containing 63
Synonyms4921511C16Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.151) question?
Stock #R7584 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location122108040-122140823 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 122113204 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Alanine at position 381 (D381A)
Ref Sequence ENSEMBL: ENSMUSP00000050582 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058960] [ENSMUST00000111751] [ENSMUST00000152389]
Predicted Effect possibly damaging
Transcript: ENSMUST00000058960
AA Change: D381A

PolyPhen 2 Score 0.734 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000050582
Gene: ENSMUSG00000043036
AA Change: D381A

DomainStartEndE-ValueType
coiled coil region 140 158 N/A INTRINSIC
coiled coil region 209 285 N/A INTRINSIC
low complexity region 308 318 N/A INTRINSIC
coiled coil region 393 438 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111751
SMART Domains Protein: ENSMUSP00000107380
Gene: ENSMUSG00000013936

DomainStartEndE-ValueType
EFh 28 56 2.81e-5 SMART
EFh 98 126 4.53e0 SMART
EFh 134 162 3.97e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000152389
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017D01Rik A G 19: 11,110,361 F69L possibly damaging Het
1700123L14Rik A C 6: 96,165,392 L224V probably benign Het
Actrt3 T C 3: 30,598,207 K246R probably benign Het
Adam23 T A 1: 63,545,462 V343D probably damaging Het
Ak2 T C 4: 128,999,212 S55P probably damaging Het
Ank2 G A 3: 126,946,128 Q2036* probably null Het
Ano10 A G 9: 122,275,531 I40T probably benign Het
Aoc2 T A 11: 101,326,179 C363S possibly damaging Het
Aplp2 A T 9: 31,157,781 V584E possibly damaging Het
Arhgap32 A T 9: 32,256,967 T749S probably benign Het
Atm A T 9: 53,513,127 F625I probably damaging Het
Atr T C 9: 95,942,713 L2387P probably damaging Het
Barhl1 C T 2: 28,909,791 G274D probably damaging Het
Bcl2a1a A T 9: 88,957,292 D81V probably damaging Het
Col12a1 A G 9: 79,703,296 probably null Het
Crat C T 2: 30,404,565 R497Q probably benign Het
Cyp4b1 T A 4: 115,628,687 D351V probably damaging Het
D130043K22Rik A G 13: 24,872,370 S562G probably damaging Het
D430042O09Rik G T 7: 125,870,666 V1436L probably damaging Het
Dmbt1 C T 7: 131,088,751 Q905* probably null Het
Dnajc21 A C 15: 10,462,295 Y81* probably null Het
Dnali1 T C 4: 125,065,538 T21A probably benign Het
Dpp8 A T 9: 65,078,782 L851F probably damaging Het
Dpt T C 1: 164,818,908 Y149H probably benign Het
Ep300 T C 15: 81,628,426 V983A unknown Het
Faf1 C T 4: 109,925,957 R549C probably damaging Het
Gcm1 A G 9: 78,064,467 N230S possibly damaging Het
Gm10803 T A 2: 93,564,168 I95N probably damaging Het
Hectd4 T A 5: 121,318,735 I721N possibly damaging Het
Hsp90ab1 T C 17: 45,570,271 H315R probably damaging Het
Igkv10-95 T A 6: 68,680,756 S85R possibly damaging Het
Kcnq5 T C 1: 21,402,321 T901A probably benign Het
Kremen1 C T 11: 5,194,964 V471M possibly damaging Het
Lama2 C A 10: 27,104,261 D1853Y possibly damaging Het
Lrif1 A G 3: 106,731,901 T76A probably benign Het
Lrrtm2 T A 18: 35,212,765 I495F possibly damaging Het
Ltbr G T 6: 125,307,241 Q413K probably benign Het
Myrfl T A 10: 116,828,997 Y376F probably damaging Het
Nup98 G T 7: 102,176,389 N414K probably benign Het
Nynrin A G 14: 55,871,584 T1383A probably damaging Het
Olfr1106 A T 2: 87,049,134 I34N probably benign Het
Olfr1211 G A 2: 88,929,805 P170L probably damaging Het
Olfr784 T A 10: 129,388,032 I133N probably damaging Het
Olfr845 C A 9: 19,339,273 T271K possibly damaging Het
Olfr915 G T 9: 38,646,895 P210T possibly damaging Het
Pcdhb5 T A 18: 37,322,372 S602T possibly damaging Het
Sall3 A G 18: 80,974,530 F61S probably benign Het
Scube1 G T 15: 83,721,887 C61* probably null Het
Sec31b T C 19: 44,543,323 D49G probably damaging Het
Skiv2l A G 17: 34,841,675 I822T possibly damaging Het
Slc19a3 C T 1: 83,022,748 V183M possibly damaging Het
Slc41a2 T C 10: 83,316,789 probably benign Het
Sphk2 C A 7: 45,712,507 V169L probably damaging Het
Synpo C A 18: 60,596,277 R951L probably damaging Het
Tbc1d9b G A 11: 50,170,716 C1017Y probably damaging Het
Tmtc4 C A 14: 122,978,151 V28F probably benign Het
Tprkb A G 6: 85,928,827 I165V probably benign Het
Ttc23l T A 15: 10,533,708 I250F probably damaging Het
Ube3c TTCTCTC TTCTCTCTCTC 5: 29,637,629 probably benign Het
Ubr3 G A 2: 69,991,503 V1370I probably damaging Het
Ush2a A G 1: 188,728,109 probably null Het
Usp9y T C Y: 1,384,451 Y689C probably damaging Het
Vmn1r56 A T 7: 5,195,896 Y241N probably damaging Het
Vmn2r6 T C 3: 64,565,262 T13A probably benign Het
Vmn2r92 T A 17: 18,166,766 N122K probably benign Het
Vps9d1 A G 8: 123,250,717 F131S probably damaging Het
Vwa8 A C 14: 78,982,234 probably null Het
Zbtb41 T A 1: 139,424,057 Y303N probably benign Het
Zbtb5 T C 4: 44,993,678 T569A probably benign Het
Zcchc11 T C 4: 108,479,346 V89A probably benign Het
Zfp111 A G 7: 24,198,600 S530P possibly damaging Het
Other mutations in Ccdc63
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00919:Ccdc63 APN 5 122124919 splice site probably benign
IGL01660:Ccdc63 APN 5 122110964 missense possibly damaging 0.81
IGL01773:Ccdc63 APN 5 122113145 missense possibly damaging 0.93
IGL02341:Ccdc63 APN 5 122113198 missense probably benign 0.00
IGL03030:Ccdc63 APN 5 122122813 missense probably benign 0.00
IGL02991:Ccdc63 UTSW 5 122108212 missense probably benign 0.10
R0267:Ccdc63 UTSW 5 122117044 splice site probably benign
R0961:Ccdc63 UTSW 5 122110946 missense possibly damaging 0.75
R1333:Ccdc63 UTSW 5 122108161 missense probably benign 0.04
R1802:Ccdc63 UTSW 5 122129877 missense probably damaging 1.00
R1999:Ccdc63 UTSW 5 122127565 missense possibly damaging 0.72
R2048:Ccdc63 UTSW 5 122130287 critical splice donor site probably null
R2150:Ccdc63 UTSW 5 122127565 missense possibly damaging 0.72
R2350:Ccdc63 UTSW 5 122122885 missense probably benign 0.04
R4049:Ccdc63 UTSW 5 122122750 missense probably damaging 0.99
R5072:Ccdc63 UTSW 5 122121055 missense probably benign 0.28
R5847:Ccdc63 UTSW 5 122116845 missense possibly damaging 0.78
R6031:Ccdc63 UTSW 5 122129736 missense possibly damaging 0.74
R6031:Ccdc63 UTSW 5 122129736 missense possibly damaging 0.74
R6249:Ccdc63 UTSW 5 122124999 missense probably benign 0.17
R6782:Ccdc63 UTSW 5 122111014 nonsense probably null
R7073:Ccdc63 UTSW 5 122111010 missense probably benign 0.00
R7250:Ccdc63 UTSW 5 122122843 missense probably damaging 1.00
R7448:Ccdc63 UTSW 5 122108182 missense probably benign 0.00
R7773:Ccdc63 UTSW 5 122109272 missense probably damaging 1.00
R7856:Ccdc63 UTSW 5 122129943 missense probably benign 0.00
R7939:Ccdc63 UTSW 5 122129943 missense probably benign 0.00
X0028:Ccdc63 UTSW 5 122109175 missense possibly damaging 0.50
Predicted Primers PCR Primer
(F):5'- TTGTGTCTGAACAGGCCATC -3'
(R):5'- GTGAGAGATGATGCTGACTTCTC -3'

Sequencing Primer
(F):5'- TGTCTGAACAGGCCATCTGACAG -3'
(R):5'- GAGAGCTACTGCACTAGATAGTTC -3'
Posted On2019-10-24