Incidental Mutation 'R7584:Tprkb'
ID586962
Institutional Source Beutler Lab
Gene Symbol Tprkb
Ensembl Gene ENSMUSG00000054226
Gene NameTp53rk binding protein
Synonyms1810034M08Rik, DRWMS1, 0610033G21Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.285) question?
Stock #R7584 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location85911865-85930284 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 85928827 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 165 (I165V)
Ref Sequence ENSEMBL: ENSMUSP00000063927 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067137] [ENSMUST00000089570] [ENSMUST00000113751] [ENSMUST00000113752] [ENSMUST00000113753] [ENSMUST00000149026] [ENSMUST00000200680] [ENSMUST00000201939] [ENSMUST00000202803]
Predicted Effect probably benign
Transcript: ENSMUST00000067137
AA Change: I165V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000063927
Gene: ENSMUSG00000054226
AA Change: I165V

DomainStartEndE-ValueType
Pfam:CGI-121 20 172 1.2e-45 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000089570
SMART Domains Protein: ENSMUSP00000086998
Gene: ENSMUSG00000054226

DomainStartEndE-ValueType
Pfam:CGI-121 20 150 8.6e-39 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113751
SMART Domains Protein: ENSMUSP00000109380
Gene: ENSMUSG00000054226

DomainStartEndE-ValueType
Pfam:CGI-121 20 91 1.2e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113752
AA Change: I165V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000109381
Gene: ENSMUSG00000054226
AA Change: I165V

DomainStartEndE-ValueType
Pfam:CGI-121 20 172 1.3e-47 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113753
AA Change: I165V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000109382
Gene: ENSMUSG00000054226
AA Change: I165V

DomainStartEndE-ValueType
Pfam:CGI-121 20 172 1.2e-45 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000149026
SMART Domains Protein: ENSMUSP00000117259
Gene: ENSMUSG00000054226

DomainStartEndE-ValueType
Pfam:CGI-121 20 132 1.4e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000200680
AA Change: I165V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000144160
Gene: ENSMUSG00000054226
AA Change: I165V

DomainStartEndE-ValueType
Pfam:CGI-121 20 172 1.3e-47 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000201939
SMART Domains Protein: ENSMUSP00000144588
Gene: ENSMUSG00000054226

DomainStartEndE-ValueType
Pfam:CGI-121 20 110 9.4e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000202803
SMART Domains Protein: ENSMUSP00000144660
Gene: ENSMUSG00000054226

DomainStartEndE-ValueType
Pfam:CGI-121 20 149 1.6e-40 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017D01Rik A G 19: 11,110,361 F69L possibly damaging Het
1700123L14Rik A C 6: 96,165,392 L224V probably benign Het
Actrt3 T C 3: 30,598,207 K246R probably benign Het
Adam23 T A 1: 63,545,462 V343D probably damaging Het
Ak2 T C 4: 128,999,212 S55P probably damaging Het
Ank2 G A 3: 126,946,128 Q2036* probably null Het
Ano10 A G 9: 122,275,531 I40T probably benign Het
Aoc2 T A 11: 101,326,179 C363S possibly damaging Het
Aplp2 A T 9: 31,157,781 V584E possibly damaging Het
Arhgap32 A T 9: 32,256,967 T749S probably benign Het
Atm A T 9: 53,513,127 F625I probably damaging Het
Atr T C 9: 95,942,713 L2387P probably damaging Het
Barhl1 C T 2: 28,909,791 G274D probably damaging Het
Bcl2a1a A T 9: 88,957,292 D81V probably damaging Het
Ccdc63 T G 5: 122,113,204 D381A possibly damaging Het
Col12a1 A G 9: 79,703,296 probably null Het
Crat C T 2: 30,404,565 R497Q probably benign Het
Cyp4b1 T A 4: 115,628,687 D351V probably damaging Het
D130043K22Rik A G 13: 24,872,370 S562G probably damaging Het
D430042O09Rik G T 7: 125,870,666 V1436L probably damaging Het
Dmbt1 C T 7: 131,088,751 Q905* probably null Het
Dnajc21 A C 15: 10,462,295 Y81* probably null Het
Dnali1 T C 4: 125,065,538 T21A probably benign Het
Dpp8 A T 9: 65,078,782 L851F probably damaging Het
Dpt T C 1: 164,818,908 Y149H probably benign Het
Ep300 T C 15: 81,628,426 V983A unknown Het
Faf1 C T 4: 109,925,957 R549C probably damaging Het
Gcm1 A G 9: 78,064,467 N230S possibly damaging Het
Gm10803 T A 2: 93,564,168 I95N probably damaging Het
Hectd4 T A 5: 121,318,735 I721N possibly damaging Het
Hsp90ab1 T C 17: 45,570,271 H315R probably damaging Het
Igkv10-95 T A 6: 68,680,756 S85R possibly damaging Het
Kcnq5 T C 1: 21,402,321 T901A probably benign Het
Kremen1 C T 11: 5,194,964 V471M possibly damaging Het
Lama2 C A 10: 27,104,261 D1853Y possibly damaging Het
Lrif1 A G 3: 106,731,901 T76A probably benign Het
Lrrtm2 T A 18: 35,212,765 I495F possibly damaging Het
Ltbr G T 6: 125,307,241 Q413K probably benign Het
Myrfl T A 10: 116,828,997 Y376F probably damaging Het
Nup98 G T 7: 102,176,389 N414K probably benign Het
Nynrin A G 14: 55,871,584 T1383A probably damaging Het
Olfr1106 A T 2: 87,049,134 I34N probably benign Het
Olfr1211 G A 2: 88,929,805 P170L probably damaging Het
Olfr784 T A 10: 129,388,032 I133N probably damaging Het
Olfr845 C A 9: 19,339,273 T271K possibly damaging Het
Olfr915 G T 9: 38,646,895 P210T possibly damaging Het
Pcdhb5 T A 18: 37,322,372 S602T possibly damaging Het
Sall3 A G 18: 80,974,530 F61S probably benign Het
Scube1 G T 15: 83,721,887 C61* probably null Het
Sec31b T C 19: 44,543,323 D49G probably damaging Het
Skiv2l A G 17: 34,841,675 I822T possibly damaging Het
Slc19a3 C T 1: 83,022,748 V183M possibly damaging Het
Slc41a2 T C 10: 83,316,789 probably benign Het
Sphk2 C A 7: 45,712,507 V169L probably damaging Het
Synpo C A 18: 60,596,277 R951L probably damaging Het
Tbc1d9b G A 11: 50,170,716 C1017Y probably damaging Het
Tmtc4 C A 14: 122,978,151 V28F probably benign Het
Ttc23l T A 15: 10,533,708 I250F probably damaging Het
Ube3c TTCTCTC TTCTCTCTCTC 5: 29,637,629 probably benign Het
Ubr3 G A 2: 69,991,503 V1370I probably damaging Het
Ush2a A G 1: 188,728,109 probably null Het
Usp9y T C Y: 1,384,451 Y689C probably damaging Het
Vmn1r56 A T 7: 5,195,896 Y241N probably damaging Het
Vmn2r6 T C 3: 64,565,262 T13A probably benign Het
Vmn2r92 T A 17: 18,166,766 N122K probably benign Het
Vps9d1 A G 8: 123,250,717 F131S probably damaging Het
Vwa8 A C 14: 78,982,234 probably null Het
Zbtb41 T A 1: 139,424,057 Y303N probably benign Het
Zbtb5 T C 4: 44,993,678 T569A probably benign Het
Zcchc11 T C 4: 108,479,346 V89A probably benign Het
Zfp111 A G 7: 24,198,600 S530P possibly damaging Het
Other mutations in Tprkb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02133:Tprkb APN 6 85927911 missense probably benign 0.00
IGL02981:Tprkb APN 6 85927879 missense probably benign 0.01
IGL03102:Tprkb APN 6 85924418 missense probably benign 0.04
F5770:Tprkb UTSW 6 85928782 missense probably damaging 0.96
R0491:Tprkb UTSW 6 85924464 missense probably benign 0.02
R1456:Tprkb UTSW 6 85924421 missense probably damaging 0.97
R2007:Tprkb UTSW 6 85933048 unclassified probably benign
R2088:Tprkb UTSW 6 85932940 unclassified probably benign
R3960:Tprkb UTSW 6 85928801 missense probably benign 0.02
R6153:Tprkb UTSW 6 85916190 intron probably null
V7581:Tprkb UTSW 6 85928782 missense probably damaging 0.96
V7582:Tprkb UTSW 6 85928782 missense probably damaging 0.96
V7583:Tprkb UTSW 6 85928782 missense probably damaging 0.96
X0064:Tprkb UTSW 6 85928800 missense probably benign 0.39
X0064:Tprkb UTSW 6 85928802 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGACAAATTGCCAACAACTTTGA -3'
(R):5'- AAGCCTATCTTGATGGATACAATCC -3'

Sequencing Primer
(F):5'- ATAGTAGCACGTGGACAC -3'
(R):5'- GTGCTGGGATTAAAGGCA -3'
Posted On2019-10-24