Incidental Mutation 'R7584:Sphk2'
ID586967
Institutional Source Beutler Lab
Gene Symbol Sphk2
Ensembl Gene ENSMUSG00000057342
Gene Namesphingosine kinase 2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7584 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location45709467-45718002 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 45712507 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 169 (V169L)
Ref Sequence ENSEMBL: ENSMUSP00000072615 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072836] [ENSMUST00000080885] [ENSMUST00000107737] [ENSMUST00000210060] [ENSMUST00000210640] [ENSMUST00000211340] [ENSMUST00000211357] [ENSMUST00000211513]
Predicted Effect probably damaging
Transcript: ENSMUST00000072836
AA Change: V169L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000072615
Gene: ENSMUSG00000057342
AA Change: V169L

DomainStartEndE-ValueType
SCOP:d1epfa2 63 87 1e-2 SMART
DAGKc 147 284 4.49e-5 SMART
low complexity region 369 376 N/A INTRINSIC
low complexity region 429 440 N/A INTRINSIC
PDB:3VZB|C 468 609 4e-25 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000080885
SMART Domains Protein: ENSMUSP00000079693
Gene: ENSMUSG00000059824

DomainStartEndE-ValueType
low complexity region 10 31 N/A INTRINSIC
low complexity region 71 98 N/A INTRINSIC
low complexity region 127 171 N/A INTRINSIC
BRLZ 253 317 5.17e-8 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000107737
AA Change: V169L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000103366
Gene: ENSMUSG00000057342
AA Change: V169L

DomainStartEndE-ValueType
SCOP:d1epfa2 63 87 1e-2 SMART
DAGKc 147 284 4.49e-5 SMART
low complexity region 369 376 N/A INTRINSIC
low complexity region 429 440 N/A INTRINSIC
PDB:3VZB|C 468 609 4e-25 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000210060
AA Change: V169L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably benign
Transcript: ENSMUST00000210640
Predicted Effect probably benign
Transcript: ENSMUST00000211340
Predicted Effect probably benign
Transcript: ENSMUST00000211357
Predicted Effect probably benign
Transcript: ENSMUST00000211513
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a kinase that phosphorylates sphingosine into sphingosine-1-phosphate, which is involved in cell differentiation, motility, and apoptosis. The encoded protein plays a role in maintaining cellular levels of sphingosine-1-phosphate. The gene product also enhances apoptosis in different cell types and suppresses cellular proliferation. In mast cells, the encoded protein is necessary for influx of calcium, protein kinase C activation, and cytokine production and degranulation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2010]
PHENOTYPE: Mice homozygous for a disruption in this gene display a normal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017D01Rik A G 19: 11,110,361 F69L possibly damaging Het
1700123L14Rik A C 6: 96,165,392 L224V probably benign Het
Actrt3 T C 3: 30,598,207 K246R probably benign Het
Adam23 T A 1: 63,545,462 V343D probably damaging Het
Ak2 T C 4: 128,999,212 S55P probably damaging Het
Ank2 G A 3: 126,946,128 Q2036* probably null Het
Ano10 A G 9: 122,275,531 I40T probably benign Het
Aoc2 T A 11: 101,326,179 C363S possibly damaging Het
Aplp2 A T 9: 31,157,781 V584E possibly damaging Het
Arhgap32 A T 9: 32,256,967 T749S probably benign Het
Atm A T 9: 53,513,127 F625I probably damaging Het
Atr T C 9: 95,942,713 L2387P probably damaging Het
Barhl1 C T 2: 28,909,791 G274D probably damaging Het
Bcl2a1a A T 9: 88,957,292 D81V probably damaging Het
Ccdc63 T G 5: 122,113,204 D381A possibly damaging Het
Col12a1 A G 9: 79,703,296 probably null Het
Crat C T 2: 30,404,565 R497Q probably benign Het
Cyp4b1 T A 4: 115,628,687 D351V probably damaging Het
D130043K22Rik A G 13: 24,872,370 S562G probably damaging Het
D430042O09Rik G T 7: 125,870,666 V1436L probably damaging Het
Dmbt1 C T 7: 131,088,751 Q905* probably null Het
Dnajc21 A C 15: 10,462,295 Y81* probably null Het
Dnali1 T C 4: 125,065,538 T21A probably benign Het
Dpp8 A T 9: 65,078,782 L851F probably damaging Het
Dpt T C 1: 164,818,908 Y149H probably benign Het
Ep300 T C 15: 81,628,426 V983A unknown Het
Faf1 C T 4: 109,925,957 R549C probably damaging Het
Gcm1 A G 9: 78,064,467 N230S possibly damaging Het
Gm10803 T A 2: 93,564,168 I95N probably damaging Het
Hectd4 T A 5: 121,318,735 I721N possibly damaging Het
Hsp90ab1 T C 17: 45,570,271 H315R probably damaging Het
Igkv10-95 T A 6: 68,680,756 S85R possibly damaging Het
Kcnq5 T C 1: 21,402,321 T901A probably benign Het
Kremen1 C T 11: 5,194,964 V471M possibly damaging Het
Lama2 C A 10: 27,104,261 D1853Y possibly damaging Het
Lrif1 A G 3: 106,731,901 T76A probably benign Het
Lrrtm2 T A 18: 35,212,765 I495F possibly damaging Het
Ltbr G T 6: 125,307,241 Q413K probably benign Het
Myrfl T A 10: 116,828,997 Y376F probably damaging Het
Nup98 G T 7: 102,176,389 N414K probably benign Het
Nynrin A G 14: 55,871,584 T1383A probably damaging Het
Olfr1106 A T 2: 87,049,134 I34N probably benign Het
Olfr1211 G A 2: 88,929,805 P170L probably damaging Het
Olfr784 T A 10: 129,388,032 I133N probably damaging Het
Olfr845 C A 9: 19,339,273 T271K possibly damaging Het
Olfr915 G T 9: 38,646,895 P210T possibly damaging Het
Pcdhb5 T A 18: 37,322,372 S602T possibly damaging Het
Sall3 A G 18: 80,974,530 F61S probably benign Het
Scube1 G T 15: 83,721,887 C61* probably null Het
Sec31b T C 19: 44,543,323 D49G probably damaging Het
Skiv2l A G 17: 34,841,675 I822T possibly damaging Het
Slc19a3 C T 1: 83,022,748 V183M possibly damaging Het
Slc41a2 T C 10: 83,316,789 probably benign Het
Synpo C A 18: 60,596,277 R951L probably damaging Het
Tbc1d9b G A 11: 50,170,716 C1017Y probably damaging Het
Tmtc4 C A 14: 122,978,151 V28F probably benign Het
Tprkb A G 6: 85,928,827 I165V probably benign Het
Ttc23l T A 15: 10,533,708 I250F probably damaging Het
Ube3c TTCTCTC TTCTCTCTCTC 5: 29,637,629 probably benign Het
Ubr3 G A 2: 69,991,503 V1370I probably damaging Het
Ush2a A G 1: 188,728,109 probably null Het
Usp9y T C Y: 1,384,451 Y689C probably damaging Het
Vmn1r56 A T 7: 5,195,896 Y241N probably damaging Het
Vmn2r6 T C 3: 64,565,262 T13A probably benign Het
Vmn2r92 T A 17: 18,166,766 N122K probably benign Het
Vps9d1 A G 8: 123,250,717 F131S probably damaging Het
Vwa8 A C 14: 78,982,234 probably null Het
Zbtb41 T A 1: 139,424,057 Y303N probably benign Het
Zbtb5 T C 4: 44,993,678 T569A probably benign Het
Zcchc11 T C 4: 108,479,346 V89A probably benign Het
Zfp111 A G 7: 24,198,600 S530P possibly damaging Het
Other mutations in Sphk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01672:Sphk2 APN 7 45711653 missense possibly damaging 0.89
IGL01819:Sphk2 APN 7 45711056 unclassified probably null
IGL01943:Sphk2 APN 7 45710724 unclassified probably benign
IGL01981:Sphk2 APN 7 45710733 missense probably benign 0.01
R0270:Sphk2 UTSW 7 45710725 makesense probably null
R1385:Sphk2 UTSW 7 45712291 missense probably damaging 1.00
R1581:Sphk2 UTSW 7 45713496 missense probably damaging 1.00
R1634:Sphk2 UTSW 7 45711540 missense probably benign 0.03
R2009:Sphk2 UTSW 7 45711013 missense probably damaging 0.99
R4755:Sphk2 UTSW 7 45713634 missense possibly damaging 0.65
R5092:Sphk2 UTSW 7 45712353 critical splice acceptor site probably null
R6407:Sphk2 UTSW 7 45712600 missense possibly damaging 0.63
R7320:Sphk2 UTSW 7 45712470 missense possibly damaging 0.87
R7418:Sphk2 UTSW 7 45711756 missense probably damaging 1.00
R7585:Sphk2 UTSW 7 45711582 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGACACAGTGACAATGCCTTC -3'
(R):5'- ATACTGTTGCTAGGGAGGAGGC -3'

Sequencing Primer
(F):5'- AGTGACAATGCCTTCCCACTC -3'
(R):5'- CGGGATCTCCAGCCTCTC -3'
Posted On2019-10-24