Incidental Mutation 'R7584:Dmbt1'
ID 586970
Institutional Source Beutler Lab
Gene Symbol Dmbt1
Ensembl Gene ENSMUSG00000047517
Gene Name deleted in malignant brain tumors 1
Synonyms CRP-[a], Crpd, gp300, vomeroglandin, CRP-[b], ebnerin, MUCLIN, hensin
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.283) question?
Stock # R7584 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 131032053-131121630 bp(+) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) C to T at 131088751 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamine to Stop codon at position 905 (Q905*)
Ref Sequence ENSEMBL: ENSMUSP00000146685 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084509] [ENSMUST00000124096] [ENSMUST00000208311] [ENSMUST00000213064]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000084509
AA Change: Q894*
SMART Domains Protein: ENSMUSP00000081556
Gene: ENSMUSG00000047517
AA Change: Q894*

DomainStartEndE-ValueType
SR 37 137 5.54e-59 SMART
SR 186 286 3.6e-58 SMART
SR 324 424 1.21e-59 SMART
SR 463 563 2.97e-59 SMART
SR 602 702 3.36e-58 SMART
SR 741 841 5.17e-59 SMART
low complexity region 848 879 N/A INTRINSIC
CUB 884 993 4.22e-41 SMART
CUB 1000 1109 7.35e-41 SMART
CUB 1126 1235 3.73e-42 SMART
CUB 1242 1351 2.02e-38 SMART
SR 1371 1471 3.92e-59 SMART
low complexity region 1476 1488 N/A INTRINSIC
CUB 1494 1603 6.7e-44 SMART
ZP 1612 1860 8.11e-74 SMART
transmembrane domain 1906 1928 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124096
SMART Domains Protein: ENSMUSP00000130971
Gene: ENSMUSG00000030849

DomainStartEndE-ValueType
Pfam:Pkinase 1 118 4.8e-19 PFAM
Pfam:Pkinase_Tyr 1 118 1.7e-50 PFAM
low complexity region 146 160 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000208311
AA Change: Q905*
Predicted Effect probably null
Transcript: ENSMUST00000213064
AA Change: Q731*
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 99% (74/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Loss of sequences from human chromosome 10q has been associated with the progression of human cancers. This gene was originally isolated based on its deletion in a medulloblastoma cell line. This gene is expressed with transcripts of 6.0, 7.5, and 8.0 kb in fetal lung and with one transcript of 8.0 kb in adult lung, although the 7.5 kb transcript has not been characterized. The encoded protein precursor is a glycoprotein containing multiple scavenger receptor cysteine-rich (SRCR) domains separated by SRCR-interspersed domains (SID). Transcript variant 2 (8.0 kb) has been shown to bind surfactant protein D independently of carbohydrate recognition. This indicates that DMBT1 may not be a classical tumor suppressor gene, but rather play a role in the interaction of tumor cells and the immune system. [provided by RefSeq, Mar 2016]
PHENOTYPE: Mice homozygous for one null allele display embryonic lethality and an abnormal inner cell mass. Mice homozygous for a different null allele are viable and fertile with an increased susceptibility to induced colitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017D01Rik A G 19: 11,110,361 F69L possibly damaging Het
1700123L14Rik A C 6: 96,165,392 L224V probably benign Het
Abcc10 A G 17: 46,315,378 probably null Het
Actrt3 T C 3: 30,598,207 K246R probably benign Het
Adam23 T A 1: 63,545,462 V343D probably damaging Het
Ak2 T C 4: 128,999,212 S55P probably damaging Het
Ank2 G A 3: 126,946,128 Q2036* probably null Het
Ano10 A G 9: 122,275,531 I40T probably benign Het
Aoc2 T A 11: 101,326,179 C363S possibly damaging Het
Aplp2 A T 9: 31,157,781 V584E possibly damaging Het
Arhgap32 A T 9: 32,256,967 T749S probably benign Het
Atm A T 9: 53,513,127 F625I probably damaging Het
Atr T C 9: 95,942,713 L2387P probably damaging Het
Barhl1 C T 2: 28,909,791 G274D probably damaging Het
Bcl2a1a A T 9: 88,957,292 D81V probably damaging Het
Ccdc63 T G 5: 122,113,204 D381A possibly damaging Het
Col12a1 A G 9: 79,703,296 probably null Het
Crat C T 2: 30,404,565 R497Q probably benign Het
Cyp4b1 T A 4: 115,628,687 D351V probably damaging Het
D130043K22Rik A G 13: 24,872,370 S562G probably damaging Het
D430042O09Rik G T 7: 125,870,666 V1436L probably damaging Het
Dgkb T A 12: 38,139,392 probably null Het
Dnajc21 A C 15: 10,462,295 Y81* probably null Het
Dnali1 T C 4: 125,065,538 T21A probably benign Het
Dpp8 A T 9: 65,078,782 L851F probably damaging Het
Dpt T C 1: 164,818,908 Y149H probably benign Het
Ep300 T C 15: 81,628,426 V983A unknown Het
Faf1 C T 4: 109,925,957 R549C probably damaging Het
Gcm1 A G 9: 78,064,467 N230S possibly damaging Het
Gm10803 T A 2: 93,564,168 I95N probably damaging Het
Hectd4 T A 5: 121,318,735 I721N possibly damaging Het
Hsp90ab1 T C 17: 45,570,271 H315R probably damaging Het
Igkv10-95 T A 6: 68,680,756 S85R possibly damaging Het
Kcnq5 T C 1: 21,402,321 T901A probably benign Het
Kremen1 C T 11: 5,194,964 V471M possibly damaging Het
Lama2 C A 10: 27,104,261 D1853Y possibly damaging Het
Lrif1 A G 3: 106,731,901 T76A probably benign Het
Lrrtm2 T A 18: 35,212,765 I495F possibly damaging Het
Ltbr G T 6: 125,307,241 Q413K probably benign Het
Myrfl T A 10: 116,828,997 Y376F probably damaging Het
Nup98 G T 7: 102,176,389 N414K probably benign Het
Nynrin A G 14: 55,871,584 T1383A probably damaging Het
Olfr1106 A T 2: 87,049,134 I34N probably benign Het
Olfr1211 G A 2: 88,929,805 P170L probably damaging Het
Olfr784 T A 10: 129,388,032 I133N probably damaging Het
Olfr845 C A 9: 19,339,273 T271K possibly damaging Het
Olfr915 G T 9: 38,646,895 P210T possibly damaging Het
Pcdhb5 T A 18: 37,322,372 S602T possibly damaging Het
Sall3 A G 18: 80,974,530 F61S probably benign Het
Scube1 G T 15: 83,721,887 C61* probably null Het
Sec31b T C 19: 44,543,323 D49G probably damaging Het
Sec31b T C 19: 44,531,556 probably null Het
Skiv2l A G 17: 34,841,675 I822T possibly damaging Het
Slc19a3 C T 1: 83,022,748 V183M possibly damaging Het
Slc41a2 T C 10: 83,316,789 probably benign Het
Sphk2 C A 7: 45,712,507 V169L probably damaging Het
Synpo C A 18: 60,596,277 R951L probably damaging Het
Tbc1d9b G A 11: 50,170,716 C1017Y probably damaging Het
Tmtc4 C A 14: 122,978,151 V28F probably benign Het
Tprkb A G 6: 85,928,827 I165V probably benign Het
Ttc23l T A 15: 10,533,708 I250F probably damaging Het
Ubr3 G A 2: 69,991,503 V1370I probably damaging Het
Ush2a A G 1: 188,728,109 probably null Het
Usp9y T C Y: 1,384,451 Y689C probably damaging Het
Vmn1r56 A T 7: 5,195,896 Y241N probably damaging Het
Vmn2r6 T C 3: 64,565,262 T13A probably benign Het
Vmn2r92 T A 17: 18,166,766 N122K probably benign Het
Vps9d1 A G 8: 123,250,717 F131S probably damaging Het
Vwa8 A C 14: 78,982,234 probably null Het
Wfdc16 A T 2: 164,638,627 probably null Het
Zbtb41 T A 1: 139,424,057 Y303N probably benign Het
Zbtb5 T C 4: 44,993,678 T569A probably benign Het
Zcchc11 T C 4: 108,479,346 V89A probably benign Het
Zfp111 A G 7: 24,198,600 S530P possibly damaging Het
Other mutations in Dmbt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Dmbt1 APN 7 131079540 intron probably benign
IGL00161:Dmbt1 APN 7 131109628 missense probably damaging 1.00
IGL00331:Dmbt1 APN 7 131099290 missense possibly damaging 0.46
IGL00769:Dmbt1 APN 7 131082500 missense probably damaging 0.99
IGL00792:Dmbt1 APN 7 131097607 missense possibly damaging 0.66
IGL00823:Dmbt1 APN 7 131058158 missense probably benign 0.26
IGL01072:Dmbt1 APN 7 131085368 splice site probably benign
IGL01317:Dmbt1 APN 7 131041191 missense probably damaging 1.00
IGL01335:Dmbt1 APN 7 131088767 missense possibly damaging 0.95
IGL01372:Dmbt1 APN 7 131103679 missense possibly damaging 0.90
IGL01511:Dmbt1 APN 7 131116728 missense possibly damaging 0.49
IGL01627:Dmbt1 APN 7 131081185 missense probably benign 0.14
IGL01890:Dmbt1 APN 7 131074419 intron probably benign
IGL02160:Dmbt1 APN 7 131082688 missense probably damaging 1.00
IGL02186:Dmbt1 APN 7 131093256 splice site probably benign
IGL02197:Dmbt1 APN 7 131085422 splice site probably benign
IGL02332:Dmbt1 APN 7 131066613 intron probably benign
IGL02427:Dmbt1 APN 7 131088085 splice site probably null
IGL02726:Dmbt1 APN 7 131074410 intron probably benign
IGL02967:Dmbt1 APN 7 131071189 missense possibly damaging 0.70
IGL03003:Dmbt1 APN 7 131082679 missense probably benign 0.05
IGL03089:Dmbt1 APN 7 131111049 missense probably damaging 0.99
cavity UTSW 7 131112236 missense unknown
lacunar UTSW 7 131097631 missense probably damaging 0.97
BB005:Dmbt1 UTSW 7 131037890 missense probably benign 0.16
BB015:Dmbt1 UTSW 7 131037890 missense probably benign 0.16
H8562:Dmbt1 UTSW 7 131112076 nonsense probably null
K3955:Dmbt1 UTSW 7 131119564 missense probably damaging 0.98
R0051:Dmbt1 UTSW 7 131119496 missense possibly damaging 0.79
R0051:Dmbt1 UTSW 7 131119496 missense possibly damaging 0.79
R0257:Dmbt1 UTSW 7 131106393 missense probably damaging 1.00
R0388:Dmbt1 UTSW 7 131096049 splice site probably benign
R0427:Dmbt1 UTSW 7 131040902 nonsense probably null
R0478:Dmbt1 UTSW 7 131041187 missense possibly damaging 0.93
R0502:Dmbt1 UTSW 7 131097673 splice site probably null
R0538:Dmbt1 UTSW 7 131049901 splice site probably benign
R0626:Dmbt1 UTSW 7 131102081 missense probably damaging 0.97
R0631:Dmbt1 UTSW 7 131097653 missense possibly damaging 0.90
R0948:Dmbt1 UTSW 7 131093117 missense possibly damaging 0.95
R1169:Dmbt1 UTSW 7 131074524 critical splice donor site probably null
R1413:Dmbt1 UTSW 7 131050214 missense probably damaging 1.00
R1458:Dmbt1 UTSW 7 131044487 splice site probably benign
R1463:Dmbt1 UTSW 7 131109637 critical splice donor site probably null
R1509:Dmbt1 UTSW 7 131074331 intron probably benign
R1990:Dmbt1 UTSW 7 131058288 missense probably damaging 0.98
R2018:Dmbt1 UTSW 7 131110989 missense possibly damaging 0.93
R2019:Dmbt1 UTSW 7 131110989 missense possibly damaging 0.93
R2042:Dmbt1 UTSW 7 131106359 missense probably damaging 0.99
R2056:Dmbt1 UTSW 7 131106170 missense possibly damaging 0.80
R2057:Dmbt1 UTSW 7 131106170 missense possibly damaging 0.80
R2058:Dmbt1 UTSW 7 131106170 missense possibly damaging 0.80
R2059:Dmbt1 UTSW 7 131106170 missense possibly damaging 0.80
R2061:Dmbt1 UTSW 7 131099133 missense possibly damaging 0.66
R2092:Dmbt1 UTSW 7 131050018 missense probably damaging 1.00
R2102:Dmbt1 UTSW 7 131102032 missense probably damaging 0.97
R2155:Dmbt1 UTSW 7 131097575 missense possibly damaging 0.66
R2243:Dmbt1 UTSW 7 131046562 missense probably benign 0.03
R2256:Dmbt1 UTSW 7 131090494 missense probably benign 0.01
R2391:Dmbt1 UTSW 7 131106468 missense probably damaging 1.00
R2394:Dmbt1 UTSW 7 131094734 nonsense probably null
R3014:Dmbt1 UTSW 7 131032097 intron probably benign
R3155:Dmbt1 UTSW 7 131050157 nonsense probably null
R3176:Dmbt1 UTSW 7 131088071 missense probably benign 0.19
R3276:Dmbt1 UTSW 7 131088071 missense probably benign 0.19
R3442:Dmbt1 UTSW 7 131106249 missense probably damaging 1.00
R3807:Dmbt1 UTSW 7 131112090 missense possibly damaging 0.77
R4060:Dmbt1 UTSW 7 131074202 intron probably benign
R4396:Dmbt1 UTSW 7 131116632 missense probably damaging 0.98
R4453:Dmbt1 UTSW 7 131040934 missense probably damaging 1.00
R5001:Dmbt1 UTSW 7 131050012 missense probably damaging 1.00
R5051:Dmbt1 UTSW 7 131094742 missense probably benign 0.01
R5156:Dmbt1 UTSW 7 131097670 critical splice donor site probably null
R5225:Dmbt1 UTSW 7 131094735 missense possibly damaging 0.84
R5281:Dmbt1 UTSW 7 131082619 missense probably damaging 1.00
R5308:Dmbt1 UTSW 7 131041021 missense probably damaging 1.00
R5447:Dmbt1 UTSW 7 131119511 missense probably damaging 0.99
R5467:Dmbt1 UTSW 7 131040993 missense probably damaging 1.00
R5497:Dmbt1 UTSW 7 131063403 intron probably benign
R5526:Dmbt1 UTSW 7 131041190 missense probably damaging 1.00
R5554:Dmbt1 UTSW 7 131099300 nonsense probably null
R5566:Dmbt1 UTSW 7 131106273 missense probably damaging 1.00
R5595:Dmbt1 UTSW 7 131054067 missense probably benign 0.17
R6154:Dmbt1 UTSW 7 131109641 splice site probably null
R6188:Dmbt1 UTSW 7 131097631 missense probably damaging 0.97
R6214:Dmbt1 UTSW 7 131066733 missense possibly damaging 0.95
R6215:Dmbt1 UTSW 7 131066733 missense possibly damaging 0.95
R6391:Dmbt1 UTSW 7 131058254 missense probably damaging 1.00
R6397:Dmbt1 UTSW 7 131103578 missense possibly damaging 0.46
R6436:Dmbt1 UTSW 7 131116641 missense probably benign 0.01
R6603:Dmbt1 UTSW 7 131046510 splice site probably null
R6719:Dmbt1 UTSW 7 131119603 missense possibly damaging 0.83
R6781:Dmbt1 UTSW 7 131046561 missense probably benign 0.16
R7148:Dmbt1 UTSW 7 131066734 nonsense probably null
R7191:Dmbt1 UTSW 7 131044520 missense unknown
R7269:Dmbt1 UTSW 7 131066621 missense unknown
R7288:Dmbt1 UTSW 7 131083789 nonsense probably null
R7296:Dmbt1 UTSW 7 131112132 missense unknown
R7349:Dmbt1 UTSW 7 131041124 missense unknown
R7386:Dmbt1 UTSW 7 131112236 missense unknown
R7428:Dmbt1 UTSW 7 131108463 missense possibly damaging 0.53
R7481:Dmbt1 UTSW 7 131079511 critical splice acceptor site probably null
R7486:Dmbt1 UTSW 7 131066462 missense unknown
R7513:Dmbt1 UTSW 7 131090512 missense unknown
R7553:Dmbt1 UTSW 7 131104867 missense unknown
R7567:Dmbt1 UTSW 7 131061363 splice site probably null
R7736:Dmbt1 UTSW 7 131116896 missense unknown
R7758:Dmbt1 UTSW 7 131121197 missense unknown
R7928:Dmbt1 UTSW 7 131037890 missense probably benign 0.16
R8080:Dmbt1 UTSW 7 131088770 missense unknown
R8098:Dmbt1 UTSW 7 131108459 nonsense probably null
R8125:Dmbt1 UTSW 7 131099223 missense unknown
R8177:Dmbt1 UTSW 7 131106432 missense possibly damaging 0.46
R8350:Dmbt1 UTSW 7 131085417 critical splice donor site probably null
R8366:Dmbt1 UTSW 7 131066600 missense unknown
R8378:Dmbt1 UTSW 7 131106465 missense probably damaging 0.96
R8399:Dmbt1 UTSW 7 131082587 missense unknown
R8400:Dmbt1 UTSW 7 131082587 missense unknown
R8445:Dmbt1 UTSW 7 131090380 missense unknown
R8450:Dmbt1 UTSW 7 131085417 critical splice donor site probably null
R8511:Dmbt1 UTSW 7 131102012 missense unknown
R8688:Dmbt1 UTSW 7 131058254 missense unknown
R8850:Dmbt1 UTSW 7 131090404 missense unknown
R8852:Dmbt1 UTSW 7 131041123 missense unknown
R8871:Dmbt1 UTSW 7 131116868 missense unknown
R8943:Dmbt1 UTSW 7 131119643 missense possibly damaging 0.68
R8978:Dmbt1 UTSW 7 131037881 missense possibly damaging 0.53
R9004:Dmbt1 UTSW 7 131112069 missense unknown
R9020:Dmbt1 UTSW 7 131111058 missense possibly damaging 0.86
R9088:Dmbt1 UTSW 7 131116689 missense unknown
R9230:Dmbt1 UTSW 7 131037912 missense probably benign 0.01
R9304:Dmbt1 UTSW 7 131099125 missense unknown
R9377:Dmbt1 UTSW 7 131093102 missense unknown
R9428:Dmbt1 UTSW 7 131066478 missense unknown
R9474:Dmbt1 UTSW 7 131074257 missense unknown
R9573:Dmbt1 UTSW 7 131056180 critical splice donor site probably null
R9675:Dmbt1 UTSW 7 131110923 missense probably damaging 0.98
R9689:Dmbt1 UTSW 7 131058285 missense unknown
R9781:Dmbt1 UTSW 7 131037869 missense probably benign 0.00
X0024:Dmbt1 UTSW 7 131112248 nonsense probably null
X0062:Dmbt1 UTSW 7 131094851 missense possibly damaging 0.81
Z1176:Dmbt1 UTSW 7 131088812 missense unknown
Z1177:Dmbt1 UTSW 7 131082485 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- GTCCTCAGAATGTCACCAAGGC -3'
(R):5'- TGGAACCCATATTGCAAAAGCC -3'

Sequencing Primer
(F):5'- TGTCACCAAGGCTAGGTTACC -3'
(R):5'- TATTGCAAAAGCCAACATGACTATC -3'
Posted On 2019-10-24