Incidental Mutation 'R7584:Aplp2'
ID586973
Institutional Source Beutler Lab
Gene Symbol Aplp2
Ensembl Gene ENSMUSG00000031996
Gene Nameamyloid beta (A4) precursor-like protein 2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7584 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location31149557-31211815 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 31157781 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 584 (V584E)
Ref Sequence ENSEMBL: ENSMUSP00000072428 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072634] [ENSMUST00000079758] [ENSMUST00000213254] [ENSMUST00000217641]
Predicted Effect possibly damaging
Transcript: ENSMUST00000072634
AA Change: V584E

PolyPhen 2 Score 0.564 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000072428
Gene: ENSMUSG00000031996
AA Change: V584E

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
A4_EXTRA 42 204 7.91e-123 SMART
low complexity region 218 232 N/A INTRINSIC
coiled coil region 242 269 N/A INTRINSIC
KU 308 361 3.52e-24 SMART
Pfam:APP_E2 365 547 1.6e-71 PFAM
low complexity region 555 568 N/A INTRINSIC
low complexity region 589 595 N/A INTRINSIC
low complexity region 597 609 N/A INTRINSIC
Pfam:APP_amyloid 697 747 1.5e-27 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000079758
AA Change: V528E

PolyPhen 2 Score 0.703 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000078694
Gene: ENSMUSG00000031996
AA Change: V528E

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
A4_EXTRA 42 204 7.91e-123 SMART
low complexity region 218 232 N/A INTRINSIC
coiled coil region 242 269 N/A INTRINSIC
Pfam:APP_E2 307 492 2.3e-75 PFAM
low complexity region 499 512 N/A INTRINSIC
low complexity region 533 539 N/A INTRINSIC
low complexity region 541 553 N/A INTRINSIC
Pfam:APP_amyloid 652 703 1.5e-32 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000213254
AA Change: V584E

PolyPhen 2 Score 0.691 (Sensitivity: 0.86; Specificity: 0.92)
Predicted Effect probably benign
Transcript: ENSMUST00000217641
AA Change: V528E

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes amyloid precursor- like protein 2 (APLP2), which is a member of the APP (amyloid precursor protein) family including APP, APLP1 and APLP2. This protein is ubiquitously expressed. It contains heparin-, copper- and zinc- binding domains at the N-terminus, BPTI/Kunitz inhibitor and E2 domains in the middle region, and transmembrane and intracellular domains at the C-terminus. This protein interacts with major histocompatibility complex (MHC) class I molecules. The synergy of this protein and the APP is required to mediate neuromuscular transmission, spatial learning and synaptic plasticity. This protein has been implicated in the pathogenesis of Alzheimer's disease. Multiple alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Aug 2011]
PHENOTYPE: Homozygotes for two different targeted alleles show embryonic lethality, or viability and fertility with increased copper levels in cerebral cortex and liver. Double knockouts with App show high mortality, reduced growth, and neurological symptoms. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017D01Rik A G 19: 11,110,361 F69L possibly damaging Het
1700123L14Rik A C 6: 96,165,392 L224V probably benign Het
Actrt3 T C 3: 30,598,207 K246R probably benign Het
Adam23 T A 1: 63,545,462 V343D probably damaging Het
Ak2 T C 4: 128,999,212 S55P probably damaging Het
Ank2 G A 3: 126,946,128 Q2036* probably null Het
Ano10 A G 9: 122,275,531 I40T probably benign Het
Aoc2 T A 11: 101,326,179 C363S possibly damaging Het
Arhgap32 A T 9: 32,256,967 T749S probably benign Het
Atm A T 9: 53,513,127 F625I probably damaging Het
Atr T C 9: 95,942,713 L2387P probably damaging Het
Barhl1 C T 2: 28,909,791 G274D probably damaging Het
Bcl2a1a A T 9: 88,957,292 D81V probably damaging Het
Ccdc63 T G 5: 122,113,204 D381A possibly damaging Het
Col12a1 A G 9: 79,703,296 probably null Het
Crat C T 2: 30,404,565 R497Q probably benign Het
Cyp4b1 T A 4: 115,628,687 D351V probably damaging Het
D130043K22Rik A G 13: 24,872,370 S562G probably damaging Het
D430042O09Rik G T 7: 125,870,666 V1436L probably damaging Het
Dmbt1 C T 7: 131,088,751 Q905* probably null Het
Dnajc21 A C 15: 10,462,295 Y81* probably null Het
Dnali1 T C 4: 125,065,538 T21A probably benign Het
Dpp8 A T 9: 65,078,782 L851F probably damaging Het
Dpt T C 1: 164,818,908 Y149H probably benign Het
Ep300 T C 15: 81,628,426 V983A unknown Het
Faf1 C T 4: 109,925,957 R549C probably damaging Het
Gcm1 A G 9: 78,064,467 N230S possibly damaging Het
Gm10803 T A 2: 93,564,168 I95N probably damaging Het
Hectd4 T A 5: 121,318,735 I721N possibly damaging Het
Hsp90ab1 T C 17: 45,570,271 H315R probably damaging Het
Igkv10-95 T A 6: 68,680,756 S85R possibly damaging Het
Kcnq5 T C 1: 21,402,321 T901A probably benign Het
Kremen1 C T 11: 5,194,964 V471M possibly damaging Het
Lama2 C A 10: 27,104,261 D1853Y possibly damaging Het
Lrif1 A G 3: 106,731,901 T76A probably benign Het
Lrrtm2 T A 18: 35,212,765 I495F possibly damaging Het
Ltbr G T 6: 125,307,241 Q413K probably benign Het
Myrfl T A 10: 116,828,997 Y376F probably damaging Het
Nup98 G T 7: 102,176,389 N414K probably benign Het
Nynrin A G 14: 55,871,584 T1383A probably damaging Het
Olfr1106 A T 2: 87,049,134 I34N probably benign Het
Olfr1211 G A 2: 88,929,805 P170L probably damaging Het
Olfr784 T A 10: 129,388,032 I133N probably damaging Het
Olfr845 C A 9: 19,339,273 T271K possibly damaging Het
Olfr915 G T 9: 38,646,895 P210T possibly damaging Het
Pcdhb5 T A 18: 37,322,372 S602T possibly damaging Het
Sall3 A G 18: 80,974,530 F61S probably benign Het
Scube1 G T 15: 83,721,887 C61* probably null Het
Sec31b T C 19: 44,543,323 D49G probably damaging Het
Skiv2l A G 17: 34,841,675 I822T possibly damaging Het
Slc19a3 C T 1: 83,022,748 V183M possibly damaging Het
Slc41a2 T C 10: 83,316,789 probably benign Het
Sphk2 C A 7: 45,712,507 V169L probably damaging Het
Synpo C A 18: 60,596,277 R951L probably damaging Het
Tbc1d9b G A 11: 50,170,716 C1017Y probably damaging Het
Tmtc4 C A 14: 122,978,151 V28F probably benign Het
Tprkb A G 6: 85,928,827 I165V probably benign Het
Ttc23l T A 15: 10,533,708 I250F probably damaging Het
Ube3c TTCTCTC TTCTCTCTCTC 5: 29,637,629 probably benign Het
Ubr3 G A 2: 69,991,503 V1370I probably damaging Het
Ush2a A G 1: 188,728,109 probably null Het
Usp9y T C Y: 1,384,451 Y689C probably damaging Het
Vmn1r56 A T 7: 5,195,896 Y241N probably damaging Het
Vmn2r6 T C 3: 64,565,262 T13A probably benign Het
Vmn2r92 T A 17: 18,166,766 N122K probably benign Het
Vps9d1 A G 8: 123,250,717 F131S probably damaging Het
Vwa8 A C 14: 78,982,234 probably null Het
Zbtb41 T A 1: 139,424,057 Y303N probably benign Het
Zbtb5 T C 4: 44,993,678 T569A probably benign Het
Zcchc11 T C 4: 108,479,346 V89A probably benign Het
Zfp111 A G 7: 24,198,600 S530P possibly damaging Het
Other mutations in Aplp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02067:Aplp2 APN 9 31150895 missense probably damaging 1.00
IGL02152:Aplp2 APN 9 31211651 missense unknown
IGL02309:Aplp2 APN 9 31167683 missense possibly damaging 0.80
IGL02407:Aplp2 APN 9 31158527 nonsense probably null
IGL02623:Aplp2 APN 9 31178083 splice site probably benign
IGL02737:Aplp2 APN 9 31153416 missense probably benign
IGL02958:Aplp2 APN 9 31164676 splice site probably benign
R0211:Aplp2 UTSW 9 31157790 missense probably damaging 0.99
R0279:Aplp2 UTSW 9 31157790 missense probably damaging 0.99
R1669:Aplp2 UTSW 9 31167733 intron probably benign
R1707:Aplp2 UTSW 9 31150919 missense probably damaging 1.00
R1755:Aplp2 UTSW 9 31177104 missense probably damaging 1.00
R2512:Aplp2 UTSW 9 31167677 missense probably damaging 1.00
R2842:Aplp2 UTSW 9 31157826 missense probably benign 0.12
R4031:Aplp2 UTSW 9 31157730 missense probably benign 0.00
R4115:Aplp2 UTSW 9 31157826 missense probably benign 0.12
R5725:Aplp2 UTSW 9 31157814 missense probably damaging 1.00
R6032:Aplp2 UTSW 9 31150944 missense probably damaging 1.00
R6032:Aplp2 UTSW 9 31150944 missense probably damaging 1.00
R6375:Aplp2 UTSW 9 31157788 missense probably benign 0.00
R7170:Aplp2 UTSW 9 31170443 missense probably benign 0.03
R7541:Aplp2 UTSW 9 31152356 missense possibly damaging 0.82
R7711:Aplp2 UTSW 9 31161349 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCTCCCTAGTGCAATCAGG -3'
(R):5'- CCTATAAAGTCAGGCAGTAGGC -3'

Sequencing Primer
(F):5'- CTCCCTAGTGCAATCAGGTTTGAAG -3'
(R):5'- GCTCTTGCCAGGTCTTAGGTC -3'
Posted On2019-10-24