Mutagenetix > Incidental Mutations

Incidental Mutation 'R7584:Ano10'

586982

Institutional Source

Beutler Lab

Gene Symbol

Ano10

Ensembl Gene

ENSMUSG00000037949

Gene Name

anoctamin 10

Synonyms

Tmem16k

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.103) question?

Stock #

R7584 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

122175874-122294423 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 122275531 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 40 (I40T)

Ref Sequence

ENSEMBL: ENSMUSP00000045214 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000042546] [ENSMUST00000214283] [ENSMUST00000214409] [ENSMUST00000216081] [ENSMUST00000216670]

Predicted Effect

probably benign
Transcript: ENSMUST00000042546
AA Change: I40T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000045214
Gene: ENSMUSG00000037949
AA Change: I40T

Domain	Start	End	E-Value	Type
Pfam:Anoctamin	200	628	2.2e-115	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000214283
AA Change: I40T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

Predicted Effect

probably benign
Transcript: ENSMUST00000214409
AA Change: I40T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

Predicted Effect

probably benign
Transcript: ENSMUST00000216081
AA Change: I40T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

Predicted Effect

probably benign
Transcript: ENSMUST00000216670
AA Change: I40T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.8%

Validation Efficiency

99% (74/75)

MGI Phenotype

FUNCTION: This gene encodes a member of the anoctamin family, which in mammals is comprised of 10 members. Anoctamin proteins are proposed to have eight transmembrane domains with both termini facing the cytoplasm and a C-terminal domain of unknown function. While some members have been characterized as calcium-activated chloride channels, this protein is reported to inhibit anion conductance. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Dec 2012]
PHENOTYPE: Mice homozygous for a knock-out allele fail to exhibit calcium-activated chloride ion secretion in the jejunum. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 74 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700017D01Rik	A	G	19: 11,110,361	F69L	possibly damaging	Het
1700123L14Rik	A	C	6: 96,165,392	L224V	probably benign	Het
Abcc10	A	G	17: 46,315,378		probably null	Het
Actrt3	T	C	3: 30,598,207	K246R	probably benign	Het
Adam23	T	A	1: 63,545,462	V343D	probably damaging	Het
Ak2	T	C	4: 128,999,212	S55P	probably damaging	Het
Ank2	G	A	3: 126,946,128	Q2036*	probably null	Het
Aoc2	T	A	11: 101,326,179	C363S	possibly damaging	Het
Aplp2	A	T	9: 31,157,781	V584E	possibly damaging	Het
Arhgap32	A	T	9: 32,256,967	T749S	probably benign	Het
Atm	A	T	9: 53,513,127	F625I	probably damaging	Het
Atr	T	C	9: 95,942,713	L2387P	probably damaging	Het
Barhl1	C	T	2: 28,909,791	G274D	probably damaging	Het
Bcl2a1a	A	T	9: 88,957,292	D81V	probably damaging	Het
Ccdc63	T	G	5: 122,113,204	D381A	possibly damaging	Het
Col12a1	A	G	9: 79,703,296		probably null	Het
Crat	C	T	2: 30,404,565	R497Q	probably benign	Het
Cyp4b1	T	A	4: 115,628,687	D351V	probably damaging	Het
D130043K22Rik	A	G	13: 24,872,370	S562G	probably damaging	Het
D430042O09Rik	G	T	7: 125,870,666	V1436L	probably damaging	Het
Dgkb	T	A	12: 38,139,392		probably null	Het
Dmbt1	C	T	7: 131,088,751	Q905*	probably null	Het
Dnajc21	A	C	15: 10,462,295	Y81*	probably null	Het
Dnali1	T	C	4: 125,065,538	T21A	probably benign	Het
Dpp8	A	T	9: 65,078,782	L851F	probably damaging	Het
Dpt	T	C	1: 164,818,908	Y149H	probably benign	Het
Ep300	T	C	15: 81,628,426	V983A	unknown	Het
Faf1	C	T	4: 109,925,957	R549C	probably damaging	Het
Gcm1	A	G	9: 78,064,467	N230S	possibly damaging	Het
Gm10803	T	A	2: 93,564,168	I95N	probably damaging	Het
Hectd4	T	A	5: 121,318,735	I721N	possibly damaging	Het
Hsp90ab1	T	C	17: 45,570,271	H315R	probably damaging	Het
Igkv10-95	T	A	6: 68,680,756	S85R	possibly damaging	Het
Kcnq5	T	C	1: 21,402,321	T901A	probably benign	Het
Kremen1	C	T	11: 5,194,964	V471M	possibly damaging	Het
Lama2	C	A	10: 27,104,261	D1853Y	possibly damaging	Het
Lrif1	A	G	3: 106,731,901	T76A	probably benign	Het
Lrrtm2	T	A	18: 35,212,765	I495F	possibly damaging	Het
Ltbr	G	T	6: 125,307,241	Q413K	probably benign	Het
Myrfl	T	A	10: 116,828,997	Y376F	probably damaging	Het
Nup98	G	T	7: 102,176,389	N414K	probably benign	Het
Nynrin	A	G	14: 55,871,584	T1383A	probably damaging	Het
Olfr1106	A	T	2: 87,049,134	I34N	probably benign	Het
Olfr1211	G	A	2: 88,929,805	P170L	probably damaging	Het
Olfr784	T	A	10: 129,388,032	I133N	probably damaging	Het
Olfr845	C	A	9: 19,339,273	T271K	possibly damaging	Het
Olfr915	G	T	9: 38,646,895	P210T	possibly damaging	Het
Pcdhb5	T	A	18: 37,322,372	S602T	possibly damaging	Het
Sall3	A	G	18: 80,974,530	F61S	probably benign	Het
Scube1	G	T	15: 83,721,887	C61*	probably null	Het
Sec31b	T	C	19: 44,531,556		probably null	Het
Sec31b	T	C	19: 44,543,323	D49G	probably damaging	Het
Skiv2l	A	G	17: 34,841,675	I822T	possibly damaging	Het
Slc19a3	C	T	1: 83,022,748	V183M	possibly damaging	Het
Slc41a2	T	C	10: 83,316,789		probably benign	Het
Sphk2	C	A	7: 45,712,507	V169L	probably damaging	Het
Synpo	C	A	18: 60,596,277	R951L	probably damaging	Het
Tbc1d9b	G	A	11: 50,170,716	C1017Y	probably damaging	Het
Tmtc4	C	A	14: 122,978,151	V28F	probably benign	Het
Tprkb	A	G	6: 85,928,827	I165V	probably benign	Het
Ttc23l	T	A	15: 10,533,708	I250F	probably damaging	Het
Ubr3	G	A	2: 69,991,503	V1370I	probably damaging	Het
Ush2a	A	G	1: 188,728,109		probably null	Het
Usp9y	T	C	Y: 1,384,451	Y689C	probably damaging	Het
Vmn1r56	A	T	7: 5,195,896	Y241N	probably damaging	Het
Vmn2r6	T	C	3: 64,565,262	T13A	probably benign	Het
Vmn2r92	T	A	17: 18,166,766	N122K	probably benign	Het
Vps9d1	A	G	8: 123,250,717	F131S	probably damaging	Het
Vwa8	A	C	14: 78,982,234		probably null	Het
Wfdc16	A	T	2: 164,638,627		probably null	Het
Zbtb41	T	A	1: 139,424,057	Y303N	probably benign	Het
Zbtb5	T	C	4: 44,993,678	T569A	probably benign	Het
Zcchc11	T	C	4: 108,479,346	V89A	probably benign	Het
Zfp111	A	G	7: 24,198,600	S530P	possibly damaging	Het

Other mutations in Ano10

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00545:Ano10	APN	9	122261356	missense	possibly damaging	0.96
IGL00886:Ano10	APN	9	122271324	missense	probably benign	0.01
IGL00932:Ano10	APN	9	122251231	nonsense	probably null
IGL01613:Ano10	APN	9	122259540	missense	possibly damaging	0.75
IGL02109:Ano10	APN	9	122261342	missense	probably damaging	1.00
IGL02397:Ano10	APN	9	122261392	missense	probably damaging	1.00
IGL02512:Ano10	APN	9	122272474	missense	possibly damaging	0.50
IGL03216:Ano10	APN	9	122257061	missense	probably damaging	1.00
arna	UTSW	9	122259564	missense	possibly damaging	0.77
R0624:Ano10	UTSW	9	122259595	splice site	probably benign
R1669:Ano10	UTSW	9	122257183	missense	possibly damaging	0.94
R1801:Ano10	UTSW	9	122253030	missense	probably damaging	1.00
R2511:Ano10	UTSW	9	122258945	missense	probably damaging	0.99
R3836:Ano10	UTSW	9	122263763	missense	possibly damaging	0.58
R4027:Ano10	UTSW	9	122252928	splice site	probably benign
R4151:Ano10	UTSW	9	122261535	nonsense	probably null
R4590:Ano10	UTSW	9	122257165	missense	probably benign	0.22
R4651:Ano10	UTSW	9	122261115	nonsense	probably null
R4652:Ano10	UTSW	9	122261115	nonsense	probably null
R4676:Ano10	UTSW	9	122263787	missense	probably damaging	0.98
R5026:Ano10	UTSW	9	122272559	nonsense	probably null
R5281:Ano10	UTSW	9	122261486	missense	probably damaging	1.00
R5401:Ano10	UTSW	9	122261290	missense	probably damaging	1.00
R6269:Ano10	UTSW	9	122261242	missense	probably damaging	0.99
R6449:Ano10	UTSW	9	122201688	intron	probably benign
R6702:Ano10	UTSW	9	122259564	missense	possibly damaging	0.77
R7010:Ano10	UTSW	9	122253124	missense	probably damaging	1.00
R7384:Ano10	UTSW	9	122176343	missense	unknown

Predicted Primers

PCR Primer
(F):5'- TCTGGGCACTGTGTTAGACATG -3'
(R):5'- TGCTTTCCTCCCAGAATGACTG -3'

Sequencing Primer
(F):5'- TGTAGAAAGCCACTTACAGGGCTC -3'
(R):5'- CAGAATGACTGGATTTTGCTTTTTG -3'

Posted On

2019-10-24