Incidental Mutation 'R7584:Kremen1'
ID586987
Institutional Source Beutler Lab
Gene Symbol Kremen1
Ensembl Gene ENSMUSG00000020393
Gene Namekringle containing transmembrane protein 1
SynonymsKrm1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.108) question?
Stock #R7584 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location5191552-5261558 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 5194964 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 471 (V471M)
Ref Sequence ENSEMBL: ENSMUSP00000020662 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020662]
Predicted Effect possibly damaging
Transcript: ENSMUST00000020662
AA Change: V471M

PolyPhen 2 Score 0.947 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000020662
Gene: ENSMUSG00000020393
AA Change: V471M

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
KR 30 116 9.81e-23 SMART
Pfam:WSC 119 200 3.7e-21 PFAM
CUB 214 321 4.27e-19 SMART
transmembrane domain 391 413 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 99% (74/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a high-affinity dickkopf homolog 1 (DKK1) transmembrane receptor that functionally cooperates with DKK1 to block wingless (WNT)/beta-catenin signaling. The encoded protein is a component of a membrane complex that modulates canonical WNT signaling through lipoprotein receptor-related protein 6 (LRP6). It contains extracellular kringle, WSC, and CUB domains. Alternatively spliced transcript variants encoding distinct isoforms have been observed for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit no abnormal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017D01Rik A G 19: 11,110,361 F69L possibly damaging Het
1700123L14Rik A C 6: 96,165,392 L224V probably benign Het
Abcc10 A G 17: 46,315,378 probably null Het
Actrt3 T C 3: 30,598,207 K246R probably benign Het
Adam23 T A 1: 63,545,462 V343D probably damaging Het
Ak2 T C 4: 128,999,212 S55P probably damaging Het
Ank2 G A 3: 126,946,128 Q2036* probably null Het
Ano10 A G 9: 122,275,531 I40T probably benign Het
Aoc2 T A 11: 101,326,179 C363S possibly damaging Het
Aplp2 A T 9: 31,157,781 V584E possibly damaging Het
Arhgap32 A T 9: 32,256,967 T749S probably benign Het
Atm A T 9: 53,513,127 F625I probably damaging Het
Atr T C 9: 95,942,713 L2387P probably damaging Het
Barhl1 C T 2: 28,909,791 G274D probably damaging Het
Bcl2a1a A T 9: 88,957,292 D81V probably damaging Het
Ccdc63 T G 5: 122,113,204 D381A possibly damaging Het
Col12a1 A G 9: 79,703,296 probably null Het
Crat C T 2: 30,404,565 R497Q probably benign Het
Cyp4b1 T A 4: 115,628,687 D351V probably damaging Het
D130043K22Rik A G 13: 24,872,370 S562G probably damaging Het
D430042O09Rik G T 7: 125,870,666 V1436L probably damaging Het
Dgkb T A 12: 38,139,392 probably null Het
Dmbt1 C T 7: 131,088,751 Q905* probably null Het
Dnajc21 A C 15: 10,462,295 Y81* probably null Het
Dnali1 T C 4: 125,065,538 T21A probably benign Het
Dpp8 A T 9: 65,078,782 L851F probably damaging Het
Dpt T C 1: 164,818,908 Y149H probably benign Het
Ep300 T C 15: 81,628,426 V983A unknown Het
Faf1 C T 4: 109,925,957 R549C probably damaging Het
Gcm1 A G 9: 78,064,467 N230S possibly damaging Het
Gm10803 T A 2: 93,564,168 I95N probably damaging Het
Hectd4 T A 5: 121,318,735 I721N possibly damaging Het
Hsp90ab1 T C 17: 45,570,271 H315R probably damaging Het
Igkv10-95 T A 6: 68,680,756 S85R possibly damaging Het
Kcnq5 T C 1: 21,402,321 T901A probably benign Het
Lama2 C A 10: 27,104,261 D1853Y possibly damaging Het
Lrif1 A G 3: 106,731,901 T76A probably benign Het
Lrrtm2 T A 18: 35,212,765 I495F possibly damaging Het
Ltbr G T 6: 125,307,241 Q413K probably benign Het
Myrfl T A 10: 116,828,997 Y376F probably damaging Het
Nup98 G T 7: 102,176,389 N414K probably benign Het
Nynrin A G 14: 55,871,584 T1383A probably damaging Het
Olfr1106 A T 2: 87,049,134 I34N probably benign Het
Olfr1211 G A 2: 88,929,805 P170L probably damaging Het
Olfr784 T A 10: 129,388,032 I133N probably damaging Het
Olfr845 C A 9: 19,339,273 T271K possibly damaging Het
Olfr915 G T 9: 38,646,895 P210T possibly damaging Het
Pcdhb5 T A 18: 37,322,372 S602T possibly damaging Het
Sall3 A G 18: 80,974,530 F61S probably benign Het
Scube1 G T 15: 83,721,887 C61* probably null Het
Sec31b T C 19: 44,531,556 probably null Het
Sec31b T C 19: 44,543,323 D49G probably damaging Het
Skiv2l A G 17: 34,841,675 I822T possibly damaging Het
Slc19a3 C T 1: 83,022,748 V183M possibly damaging Het
Slc41a2 T C 10: 83,316,789 probably benign Het
Sphk2 C A 7: 45,712,507 V169L probably damaging Het
Synpo C A 18: 60,596,277 R951L probably damaging Het
Tbc1d9b G A 11: 50,170,716 C1017Y probably damaging Het
Tmtc4 C A 14: 122,978,151 V28F probably benign Het
Tprkb A G 6: 85,928,827 I165V probably benign Het
Ttc23l T A 15: 10,533,708 I250F probably damaging Het
Ubr3 G A 2: 69,991,503 V1370I probably damaging Het
Ush2a A G 1: 188,728,109 probably null Het
Usp9y T C Y: 1,384,451 Y689C probably damaging Het
Vmn1r56 A T 7: 5,195,896 Y241N probably damaging Het
Vmn2r6 T C 3: 64,565,262 T13A probably benign Het
Vmn2r92 T A 17: 18,166,766 N122K probably benign Het
Vps9d1 A G 8: 123,250,717 F131S probably damaging Het
Vwa8 A C 14: 78,982,234 probably null Het
Wfdc16 A T 2: 164,638,627 probably null Het
Zbtb41 T A 1: 139,424,057 Y303N probably benign Het
Zbtb5 T C 4: 44,993,678 T569A probably benign Het
Zcchc11 T C 4: 108,479,346 V89A probably benign Het
Zfp111 A G 7: 24,198,600 S530P possibly damaging Het
Other mutations in Kremen1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01813:Kremen1 APN 11 5199667 missense probably benign 0.00
R0038:Kremen1 UTSW 11 5207703 splice site probably benign
R0511:Kremen1 UTSW 11 5215447 missense probably damaging 1.00
R1557:Kremen1 UTSW 11 5215373 intron probably null
R1579:Kremen1 UTSW 11 5201791 unclassified probably benign
R1729:Kremen1 UTSW 11 5201791 unclassified probably benign
R1784:Kremen1 UTSW 11 5201792 unclassified probably benign
R1800:Kremen1 UTSW 11 5201791 unclassified probably benign
R2079:Kremen1 UTSW 11 5201794 frame shift probably null
R2100:Kremen1 UTSW 11 5201788 unclassified probably benign
R2286:Kremen1 UTSW 11 5201791 unclassified probably benign
R2298:Kremen1 UTSW 11 5201788 unclassified probably benign
R2352:Kremen1 UTSW 11 5201791 unclassified probably benign
R2512:Kremen1 UTSW 11 5201791 unclassified probably benign
R2761:Kremen1 UTSW 11 5201792 unclassified probably benign
R2846:Kremen1 UTSW 11 5201793 unclassified probably benign
R2882:Kremen1 UTSW 11 5201791 unclassified probably benign
R2944:Kremen1 UTSW 11 5201791 unclassified probably benign
R2980:Kremen1 UTSW 11 5201794 unclassified probably benign
R3151:Kremen1 UTSW 11 5195012 missense probably damaging 0.99
R3610:Kremen1 UTSW 11 5201791 unclassified probably benign
R3831:Kremen1 UTSW 11 5201794 unclassified probably benign
R3957:Kremen1 UTSW 11 5201791 unclassified probably benign
R4231:Kremen1 UTSW 11 5243881 nonsense probably null
R4397:Kremen1 UTSW 11 5199610 missense probably benign 0.36
R5627:Kremen1 UTSW 11 5199709 missense probably benign 0.01
R6818:Kremen1 UTSW 11 5195051 missense probably benign 0.02
T0975:Kremen1 UTSW 11 5195105 missense probably benign 0.02
Y4339:Kremen1 UTSW 11 5201791 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- CTGGTACATGTGATGGAGGATC -3'
(R):5'- ATCTTAAGTCTCTGAGGCAGC -3'

Sequencing Primer
(F):5'- CATGTGATGGAGGATCCCAGGC -3'
(R):5'- ACAGGCAGTGTCACAGGTC -3'
Posted On2019-10-24