Incidental Mutation 'R7584:Aoc2'
ID586989
Institutional Source Beutler Lab
Gene Symbol Aoc2
Ensembl Gene ENSMUSG00000078651
Gene Nameamine oxidase, copper containing 2 (retina-specific)
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.163) question?
Stock #R7584 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location101325063-101329702 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 101326179 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 363 (C363S)
Ref Sequence ENSEMBL: ENSMUSP00000040255 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017316] [ENSMUST00000019470] [ENSMUST00000041095] [ENSMUST00000103105] [ENSMUST00000107264]
Predicted Effect probably benign
Transcript: ENSMUST00000017316
SMART Domains Protein: ENSMUSP00000017316
Gene: ENSMUSG00000019326

DomainStartEndE-ValueType
Pfam:Cu_amine_oxidN2 23 109 4.3e-24 PFAM
Pfam:Cu_amine_oxidN3 126 226 1.4e-28 PFAM
Pfam:Cu_amine_oxid 251 444 4.2e-51 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000019470
SMART Domains Protein: ENSMUSP00000019470
Gene: ENSMUSG00000078652

DomainStartEndE-ValueType
Pfam:PA28_alpha 9 69 2.9e-30 PFAM
Pfam:PA28_beta 108 252 3e-68 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000041095
AA Change: C363S

PolyPhen 2 Score 0.495 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000040255
Gene: ENSMUSG00000078651
AA Change: C363S

DomainStartEndE-ValueType
transmembrane domain 5 26 N/A INTRINSIC
Pfam:Cu_amine_oxidN2 62 148 1.7e-29 PFAM
Pfam:Cu_amine_oxidN3 165 263 5.7e-22 PFAM
Pfam:Cu_amine_oxid 309 718 3.7e-110 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000103105
SMART Domains Protein: ENSMUSP00000099394
Gene: ENSMUSG00000019326

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
Pfam:Cu_amine_oxidN2 66 152 1.7e-29 PFAM
Pfam:Cu_amine_oxidN3 169 269 1.5e-31 PFAM
low complexity region 284 298 N/A INTRINSIC
Pfam:Cu_amine_oxid 314 721 5.3e-120 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107264
AA Change: C363S

PolyPhen 2 Score 0.060 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000102885
Gene: ENSMUSG00000078651
AA Change: C363S

DomainStartEndE-ValueType
transmembrane domain 5 26 N/A INTRINSIC
Pfam:Cu_amine_oxidN2 62 148 8.2e-24 PFAM
Pfam:Cu_amine_oxidN3 165 263 9.9e-20 PFAM
Pfam:Cu_amine_oxid 308 605 5.9e-86 PFAM
Pfam:Cu_amine_oxid 600 694 7.3e-26 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 99% (74/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Copper amine oxidases catalyze the oxidative conversion of amines to aldehydes and ammonia in the presence of copper and quinone cofactor. This gene shows high sequence similarity to copper amine oxidases from various species ranging from bacteria to mammals. The protein contains several conserved motifs including the active site of amine oxidases and the histidine residues that likely bind copper. It may be a critical modulator of signal transmission in retina, possibly by degrading the biogenic amines dopamine, histamine, and putrescine. This gene may be a candidate gene for hereditary ocular diseases. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017D01Rik A G 19: 11,110,361 F69L possibly damaging Het
1700123L14Rik A C 6: 96,165,392 L224V probably benign Het
Abcc10 A G 17: 46,315,378 probably null Het
Actrt3 T C 3: 30,598,207 K246R probably benign Het
Adam23 T A 1: 63,545,462 V343D probably damaging Het
Ak2 T C 4: 128,999,212 S55P probably damaging Het
Ank2 G A 3: 126,946,128 Q2036* probably null Het
Ano10 A G 9: 122,275,531 I40T probably benign Het
Aplp2 A T 9: 31,157,781 V584E possibly damaging Het
Arhgap32 A T 9: 32,256,967 T749S probably benign Het
Atm A T 9: 53,513,127 F625I probably damaging Het
Atr T C 9: 95,942,713 L2387P probably damaging Het
Barhl1 C T 2: 28,909,791 G274D probably damaging Het
Bcl2a1a A T 9: 88,957,292 D81V probably damaging Het
Ccdc63 T G 5: 122,113,204 D381A possibly damaging Het
Col12a1 A G 9: 79,703,296 probably null Het
Crat C T 2: 30,404,565 R497Q probably benign Het
Cyp4b1 T A 4: 115,628,687 D351V probably damaging Het
D130043K22Rik A G 13: 24,872,370 S562G probably damaging Het
D430042O09Rik G T 7: 125,870,666 V1436L probably damaging Het
Dgkb T A 12: 38,139,392 probably null Het
Dmbt1 C T 7: 131,088,751 Q905* probably null Het
Dnajc21 A C 15: 10,462,295 Y81* probably null Het
Dnali1 T C 4: 125,065,538 T21A probably benign Het
Dpp8 A T 9: 65,078,782 L851F probably damaging Het
Dpt T C 1: 164,818,908 Y149H probably benign Het
Ep300 T C 15: 81,628,426 V983A unknown Het
Faf1 C T 4: 109,925,957 R549C probably damaging Het
Gcm1 A G 9: 78,064,467 N230S possibly damaging Het
Gm10803 T A 2: 93,564,168 I95N probably damaging Het
Hectd4 T A 5: 121,318,735 I721N possibly damaging Het
Hsp90ab1 T C 17: 45,570,271 H315R probably damaging Het
Igkv10-95 T A 6: 68,680,756 S85R possibly damaging Het
Kcnq5 T C 1: 21,402,321 T901A probably benign Het
Kremen1 C T 11: 5,194,964 V471M possibly damaging Het
Lama2 C A 10: 27,104,261 D1853Y possibly damaging Het
Lrif1 A G 3: 106,731,901 T76A probably benign Het
Lrrtm2 T A 18: 35,212,765 I495F possibly damaging Het
Ltbr G T 6: 125,307,241 Q413K probably benign Het
Myrfl T A 10: 116,828,997 Y376F probably damaging Het
Nup98 G T 7: 102,176,389 N414K probably benign Het
Nynrin A G 14: 55,871,584 T1383A probably damaging Het
Olfr1106 A T 2: 87,049,134 I34N probably benign Het
Olfr1211 G A 2: 88,929,805 P170L probably damaging Het
Olfr784 T A 10: 129,388,032 I133N probably damaging Het
Olfr845 C A 9: 19,339,273 T271K possibly damaging Het
Olfr915 G T 9: 38,646,895 P210T possibly damaging Het
Pcdhb5 T A 18: 37,322,372 S602T possibly damaging Het
Sall3 A G 18: 80,974,530 F61S probably benign Het
Scube1 G T 15: 83,721,887 C61* probably null Het
Sec31b T C 19: 44,531,556 probably null Het
Sec31b T C 19: 44,543,323 D49G probably damaging Het
Skiv2l A G 17: 34,841,675 I822T possibly damaging Het
Slc19a3 C T 1: 83,022,748 V183M possibly damaging Het
Slc41a2 T C 10: 83,316,789 probably benign Het
Sphk2 C A 7: 45,712,507 V169L probably damaging Het
Synpo C A 18: 60,596,277 R951L probably damaging Het
Tbc1d9b G A 11: 50,170,716 C1017Y probably damaging Het
Tmtc4 C A 14: 122,978,151 V28F probably benign Het
Tprkb A G 6: 85,928,827 I165V probably benign Het
Ttc23l T A 15: 10,533,708 I250F probably damaging Het
Ubr3 G A 2: 69,991,503 V1370I probably damaging Het
Ush2a A G 1: 188,728,109 probably null Het
Usp9y T C Y: 1,384,451 Y689C probably damaging Het
Vmn1r56 A T 7: 5,195,896 Y241N probably damaging Het
Vmn2r6 T C 3: 64,565,262 T13A probably benign Het
Vmn2r92 T A 17: 18,166,766 N122K probably benign Het
Vps9d1 A G 8: 123,250,717 F131S probably damaging Het
Vwa8 A C 14: 78,982,234 probably null Het
Wfdc16 A T 2: 164,638,627 probably null Het
Zbtb41 T A 1: 139,424,057 Y303N probably benign Het
Zbtb5 T C 4: 44,993,678 T569A probably benign Het
Zcchc11 T C 4: 108,479,346 V89A probably benign Het
Zfp111 A G 7: 24,198,600 S530P possibly damaging Het
Other mutations in Aoc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01900:Aoc2 APN 11 101328823 missense probably damaging 1.00
IGL02340:Aoc2 APN 11 101326375 missense probably damaging 1.00
IGL02382:Aoc2 APN 11 101326672 missense probably damaging 1.00
R0063:Aoc2 UTSW 11 101326071 missense probably damaging 1.00
R0063:Aoc2 UTSW 11 101326071 missense probably damaging 1.00
R0398:Aoc2 UTSW 11 101325553 missense possibly damaging 0.56
R1430:Aoc2 UTSW 11 101326495 missense probably damaging 1.00
R1681:Aoc2 UTSW 11 101325192 missense probably benign
R3157:Aoc2 UTSW 11 101329276 missense probably damaging 1.00
R3158:Aoc2 UTSW 11 101329276 missense probably damaging 1.00
R4159:Aoc2 UTSW 11 101325296 missense probably damaging 0.98
R4747:Aoc2 UTSW 11 101328820 critical splice acceptor site probably null
R5120:Aoc2 UTSW 11 101325714 missense probably benign 0.00
R5902:Aoc2 UTSW 11 101329246 missense probably damaging 1.00
R6032:Aoc2 UTSW 11 101325801 missense probably damaging 1.00
R6032:Aoc2 UTSW 11 101325801 missense probably damaging 1.00
R6317:Aoc2 UTSW 11 101325466 missense probably damaging 1.00
R6778:Aoc2 UTSW 11 101325361 missense probably damaging 0.99
R7323:Aoc2 UTSW 11 101328545 missense probably damaging 1.00
R7491:Aoc2 UTSW 11 101328377 missense probably benign 0.14
Z1176:Aoc2 UTSW 11 101326420 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- TAGAGTCACTCCAGACCCTC -3'
(R):5'- CTGGGCCTCCTCAAATACAC -3'

Sequencing Primer
(F):5'- AGTCACTCCAGACCCTCCTCTTC -3'
(R):5'- ACAGCCCCTGGAAGCAG -3'
Posted On2019-10-24