Incidental Mutation 'R7584:Ttc23l'
ID586995
Institutional Source Beutler Lab
Gene Symbol Ttc23l
Ensembl Gene ENSMUSG00000022249
Gene Nametetratricopeptide repeat domain 23-like
Synonyms4930401A09Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.095) question?
Stock #R7584 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location10500102-10558668 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 10533708 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 250 (I250F)
Ref Sequence ENSEMBL: ENSMUSP00000022857 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022857] [ENSMUST00000167842] [ENSMUST00000167842]
Predicted Effect probably damaging
Transcript: ENSMUST00000022857
AA Change: I250F

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000022857
Gene: ENSMUSG00000022249
AA Change: I250F

DomainStartEndE-ValueType
TPR 159 192 4.21e1 SMART
Blast:TPR 208 239 2e-6 BLAST
TPR 250 283 1.4e1 SMART
low complexity region 292 303 N/A INTRINSIC
TPR 376 409 9.53e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000167842
AA Change: I250F

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000127781
Gene: ENSMUSG00000022249
AA Change: I250F

DomainStartEndE-ValueType
low complexity region 18 29 N/A INTRINSIC
Pfam:TPR_1 102 133 3.3e-6 PFAM
low complexity region 148 160 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000167842
AA Change: I250F

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017D01Rik A G 19: 11,110,361 F69L possibly damaging Het
1700123L14Rik A C 6: 96,165,392 L224V probably benign Het
Actrt3 T C 3: 30,598,207 K246R probably benign Het
Adam23 T A 1: 63,545,462 V343D probably damaging Het
Ak2 T C 4: 128,999,212 S55P probably damaging Het
Ank2 G A 3: 126,946,128 Q2036* probably null Het
Ano10 A G 9: 122,275,531 I40T probably benign Het
Aoc2 T A 11: 101,326,179 C363S possibly damaging Het
Aplp2 A T 9: 31,157,781 V584E possibly damaging Het
Arhgap32 A T 9: 32,256,967 T749S probably benign Het
Atm A T 9: 53,513,127 F625I probably damaging Het
Atr T C 9: 95,942,713 L2387P probably damaging Het
Barhl1 C T 2: 28,909,791 G274D probably damaging Het
Bcl2a1a A T 9: 88,957,292 D81V probably damaging Het
Ccdc63 T G 5: 122,113,204 D381A possibly damaging Het
Col12a1 A G 9: 79,703,296 probably null Het
Crat C T 2: 30,404,565 R497Q probably benign Het
Cyp4b1 T A 4: 115,628,687 D351V probably damaging Het
D130043K22Rik A G 13: 24,872,370 S562G probably damaging Het
D430042O09Rik G T 7: 125,870,666 V1436L probably damaging Het
Dmbt1 C T 7: 131,088,751 Q905* probably null Het
Dnajc21 A C 15: 10,462,295 Y81* probably null Het
Dnali1 T C 4: 125,065,538 T21A probably benign Het
Dpp8 A T 9: 65,078,782 L851F probably damaging Het
Dpt T C 1: 164,818,908 Y149H probably benign Het
Ep300 T C 15: 81,628,426 V983A unknown Het
Faf1 C T 4: 109,925,957 R549C probably damaging Het
Gcm1 A G 9: 78,064,467 N230S possibly damaging Het
Gm10803 T A 2: 93,564,168 I95N probably damaging Het
Hectd4 T A 5: 121,318,735 I721N possibly damaging Het
Hsp90ab1 T C 17: 45,570,271 H315R probably damaging Het
Igkv10-95 T A 6: 68,680,756 S85R possibly damaging Het
Kcnq5 T C 1: 21,402,321 T901A probably benign Het
Kremen1 C T 11: 5,194,964 V471M possibly damaging Het
Lama2 C A 10: 27,104,261 D1853Y possibly damaging Het
Lrif1 A G 3: 106,731,901 T76A probably benign Het
Lrrtm2 T A 18: 35,212,765 I495F possibly damaging Het
Ltbr G T 6: 125,307,241 Q413K probably benign Het
Myrfl T A 10: 116,828,997 Y376F probably damaging Het
Nup98 G T 7: 102,176,389 N414K probably benign Het
Nynrin A G 14: 55,871,584 T1383A probably damaging Het
Olfr1106 A T 2: 87,049,134 I34N probably benign Het
Olfr1211 G A 2: 88,929,805 P170L probably damaging Het
Olfr784 T A 10: 129,388,032 I133N probably damaging Het
Olfr845 C A 9: 19,339,273 T271K possibly damaging Het
Olfr915 G T 9: 38,646,895 P210T possibly damaging Het
Pcdhb5 T A 18: 37,322,372 S602T possibly damaging Het
Sall3 A G 18: 80,974,530 F61S probably benign Het
Scube1 G T 15: 83,721,887 C61* probably null Het
Sec31b T C 19: 44,543,323 D49G probably damaging Het
Skiv2l A G 17: 34,841,675 I822T possibly damaging Het
Slc19a3 C T 1: 83,022,748 V183M possibly damaging Het
Slc41a2 T C 10: 83,316,789 probably benign Het
Sphk2 C A 7: 45,712,507 V169L probably damaging Het
Synpo C A 18: 60,596,277 R951L probably damaging Het
Tbc1d9b G A 11: 50,170,716 C1017Y probably damaging Het
Tmtc4 C A 14: 122,978,151 V28F probably benign Het
Tprkb A G 6: 85,928,827 I165V probably benign Het
Ube3c TTCTCTC TTCTCTCTCTC 5: 29,637,629 probably benign Het
Ubr3 G A 2: 69,991,503 V1370I probably damaging Het
Ush2a A G 1: 188,728,109 probably null Het
Usp9y T C Y: 1,384,451 Y689C probably damaging Het
Vmn1r56 A T 7: 5,195,896 Y241N probably damaging Het
Vmn2r6 T C 3: 64,565,262 T13A probably benign Het
Vmn2r92 T A 17: 18,166,766 N122K probably benign Het
Vps9d1 A G 8: 123,250,717 F131S probably damaging Het
Vwa8 A C 14: 78,982,234 probably null Het
Zbtb41 T A 1: 139,424,057 Y303N probably benign Het
Zbtb5 T C 4: 44,993,678 T569A probably benign Het
Zcchc11 T C 4: 108,479,346 V89A probably benign Het
Zfp111 A G 7: 24,198,600 S530P possibly damaging Het
Other mutations in Ttc23l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01143:Ttc23l APN 15 10530689 missense probably damaging 1.00
IGL01319:Ttc23l APN 15 10509406 splice site probably benign
IGL01562:Ttc23l APN 15 10551390 splice site probably benign
IGL01969:Ttc23l APN 15 10551434 nonsense probably null
IGL03172:Ttc23l APN 15 10537566 missense probably benign 0.06
R0042:Ttc23l UTSW 15 10551541 missense probably damaging 1.00
R0042:Ttc23l UTSW 15 10551541 missense probably damaging 1.00
R0335:Ttc23l UTSW 15 10539963 missense probably benign 0.26
R0554:Ttc23l UTSW 15 10530657 missense probably benign 0.12
R0609:Ttc23l UTSW 15 10504536 missense probably benign
R0631:Ttc23l UTSW 15 10539980 missense probably damaging 1.00
R1703:Ttc23l UTSW 15 10523658 missense probably damaging 1.00
R2106:Ttc23l UTSW 15 10547256 missense probably damaging 1.00
R2220:Ttc23l UTSW 15 10537566 missense probably benign 0.06
R2276:Ttc23l UTSW 15 10523592 missense possibly damaging 0.92
R2277:Ttc23l UTSW 15 10523592 missense possibly damaging 0.92
R2278:Ttc23l UTSW 15 10523592 missense possibly damaging 0.92
R2279:Ttc23l UTSW 15 10523592 missense possibly damaging 0.92
R2368:Ttc23l UTSW 15 10537562 small insertion probably benign
R2368:Ttc23l UTSW 15 10537566 missense probably benign 0.06
R2420:Ttc23l UTSW 15 10537562 small insertion probably benign
R2420:Ttc23l UTSW 15 10537566 missense probably benign 0.06
R2421:Ttc23l UTSW 15 10537566 missense probably benign 0.06
R2422:Ttc23l UTSW 15 10537562 small insertion probably benign
R2422:Ttc23l UTSW 15 10537566 missense probably benign 0.06
R2830:Ttc23l UTSW 15 10537562 small insertion probably benign
R2831:Ttc23l UTSW 15 10537562 small insertion probably benign
R2831:Ttc23l UTSW 15 10537566 missense probably benign 0.06
R2979:Ttc23l UTSW 15 10537566 missense probably benign 0.06
R2980:Ttc23l UTSW 15 10537562 small insertion probably benign
R2980:Ttc23l UTSW 15 10537566 missense probably benign 0.06
R2981:Ttc23l UTSW 15 10537562 small insertion probably benign
R2981:Ttc23l UTSW 15 10537566 missense probably benign 0.06
R2982:Ttc23l UTSW 15 10537562 small insertion probably benign
R2982:Ttc23l UTSW 15 10537566 missense probably benign 0.06
R2983:Ttc23l UTSW 15 10537562 small insertion probably benign
R2983:Ttc23l UTSW 15 10537566 missense probably benign 0.06
R3176:Ttc23l UTSW 15 10547232 missense possibly damaging 0.83
R3177:Ttc23l UTSW 15 10547232 missense possibly damaging 0.83
R3276:Ttc23l UTSW 15 10547232 missense possibly damaging 0.83
R3277:Ttc23l UTSW 15 10547232 missense possibly damaging 0.83
R3722:Ttc23l UTSW 15 10537562 small insertion probably benign
R3722:Ttc23l UTSW 15 10537566 missense probably benign 0.06
R3743:Ttc23l UTSW 15 10537562 small insertion probably benign
R3743:Ttc23l UTSW 15 10537566 missense probably benign 0.06
R3767:Ttc23l UTSW 15 10530695 missense possibly damaging 0.94
R3921:Ttc23l UTSW 15 10537562 small insertion probably benign
R3921:Ttc23l UTSW 15 10537563 small insertion probably benign
R3921:Ttc23l UTSW 15 10537566 missense probably benign 0.06
R4091:Ttc23l UTSW 15 10537562 small insertion probably benign
R4091:Ttc23l UTSW 15 10537566 missense probably benign 0.06
R4119:Ttc23l UTSW 15 10539920 missense probably damaging 1.00
R4120:Ttc23l UTSW 15 10539920 missense probably damaging 1.00
R4373:Ttc23l UTSW 15 10537562 small insertion probably benign
R4373:Ttc23l UTSW 15 10537566 missense probably benign 0.06
R4375:Ttc23l UTSW 15 10537562 small insertion probably benign
R4375:Ttc23l UTSW 15 10537566 missense probably benign 0.06
R4376:Ttc23l UTSW 15 10537562 small insertion probably benign
R4376:Ttc23l UTSW 15 10537566 missense probably benign 0.06
R4377:Ttc23l UTSW 15 10537562 small insertion probably benign
R4377:Ttc23l UTSW 15 10537566 missense probably benign 0.06
R5002:Ttc23l UTSW 15 10551550 missense possibly damaging 0.95
R5106:Ttc23l UTSW 15 10551550 missense possibly damaging 0.95
R5107:Ttc23l UTSW 15 10551550 missense possibly damaging 0.95
R5109:Ttc23l UTSW 15 10551550 missense possibly damaging 0.95
R5156:Ttc23l UTSW 15 10551550 missense possibly damaging 0.95
R5157:Ttc23l UTSW 15 10551550 missense possibly damaging 0.95
R5160:Ttc23l UTSW 15 10551550 missense possibly damaging 0.95
R5161:Ttc23l UTSW 15 10551550 missense possibly damaging 0.95
R5259:Ttc23l UTSW 15 10515150 missense probably damaging 0.99
R5307:Ttc23l UTSW 15 10533659 missense probably damaging 1.00
R5728:Ttc23l UTSW 15 10551550 missense possibly damaging 0.95
R5756:Ttc23l UTSW 15 10551550 missense possibly damaging 0.95
R5772:Ttc23l UTSW 15 10551469 missense probably benign 0.01
R5793:Ttc23l UTSW 15 10551550 missense possibly damaging 0.95
R5794:Ttc23l UTSW 15 10551550 missense possibly damaging 0.95
R5847:Ttc23l UTSW 15 10537596 missense probably benign 0.07
R6976:Ttc23l UTSW 15 10537580 nonsense probably null
R7010:Ttc23l UTSW 15 10515138 missense probably damaging 1.00
R7342:Ttc23l UTSW 15 10551497 missense probably benign 0.01
R7404:Ttc23l UTSW 15 10551577 missense probably damaging 0.98
R7453:Ttc23l UTSW 15 10533767 missense probably damaging 1.00
R7599:Ttc23l UTSW 15 10533680 missense possibly damaging 0.89
Z1088:Ttc23l UTSW 15 10533667 missense probably damaging 1.00
Z1177:Ttc23l UTSW 15 10533633 missense not run
Predicted Primers PCR Primer
(F):5'- GCCCTGTTCTGAGAAGCAAC -3'
(R):5'- AATTCCGTATGTGTCCGCAG -3'

Sequencing Primer
(F):5'- CTGTTCTGAGAAGCAACAGGACC -3'
(R):5'- TGTCCGCAGAGTGGGTGAC -3'
Posted On2019-10-24