Incidental Mutation 'R7584:Skiv2l'
ID586999
Institutional Source Beutler Lab
Gene Symbol Skiv2l
Ensembl Gene ENSMUSG00000040356
Gene Namesuperkiller viralicidic activity 2-like (S. cerevisiae)
Synonyms4930534J06Rik, Ski2w
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7584 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location34839228-34850210 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 34841675 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 822 (I822T)
Ref Sequence ENSEMBL: ENSMUSP00000036265 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046022] [ENSMUST00000046244] [ENSMUST00000077477] [ENSMUST00000161885] [ENSMUST00000172612] [ENSMUST00000172966] [ENSMUST00000173063] [ENSMUST00000173415] [ENSMUST00000173874] [ENSMUST00000173995] [ENSMUST00000174092] [ENSMUST00000180043]
Predicted Effect possibly damaging
Transcript: ENSMUST00000046022
AA Change: I822T

PolyPhen 2 Score 0.687 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000036265
Gene: ENSMUSG00000040356
AA Change: I822T

DomainStartEndE-ValueType
low complexity region 7 22 N/A INTRINSIC
low complexity region 171 176 N/A INTRINSIC
low complexity region 208 237 N/A INTRINSIC
low complexity region 269 279 N/A INTRINSIC
DEXDc 304 487 3.61e-28 SMART
low complexity region 583 592 N/A INTRINSIC
HELICc 619 705 8.63e-17 SMART
Pfam:rRNA_proc-arch 760 1044 9.7e-39 PFAM
DSHCT 1067 1243 7.67e-77 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000046244
SMART Domains Protein: ENSMUSP00000047018
Gene: ENSMUSG00000040482

DomainStartEndE-ValueType
low complexity region 168 184 N/A INTRINSIC
Pfam:RAI1 235 303 2e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000077477
SMART Domains Protein: ENSMUSP00000076686
Gene: ENSMUSG00000061207

DomainStartEndE-ValueType
Pfam:Stk19 37 251 1e-37 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000161885
Predicted Effect probably benign
Transcript: ENSMUST00000172612
SMART Domains Protein: ENSMUSP00000133376
Gene: ENSMUSG00000040482

DomainStartEndE-ValueType
Pfam:RAI1 5 73 1.6e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000172966
Predicted Effect probably benign
Transcript: ENSMUST00000173063
Predicted Effect probably benign
Transcript: ENSMUST00000173415
AA Change: I109T

PolyPhen 2 Score 0.184 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000134209
Gene: ENSMUSG00000040356
AA Change: I109T

DomainStartEndE-ValueType
PDB:4A4Z|A 10 81 8e-14 PDB
Blast:DEXDc 19 76 2e-29 BLAST
Blast:DEXDc 136 242 9e-28 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000173874
SMART Domains Protein: ENSMUSP00000134332
Gene: ENSMUSG00000040482

DomainStartEndE-ValueType
low complexity region 168 184 N/A INTRINSIC
Pfam:RAI1 235 303 4.2e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173995
SMART Domains Protein: ENSMUSP00000134583
Gene: ENSMUSG00000040482

DomainStartEndE-ValueType
PDB:3FQJ|A 1 144 5e-99 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000174092
SMART Domains Protein: ENSMUSP00000133587
Gene: ENSMUSG00000040482

DomainStartEndE-ValueType
Pfam:RAI1 110 151 5.3e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174569
SMART Domains Protein: ENSMUSP00000133448
Gene: ENSMUSG00000040482

DomainStartEndE-ValueType
Pfam:RAI1 15 65 1.3e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174684
SMART Domains Protein: ENSMUSP00000134653
Gene: ENSMUSG00000040482

DomainStartEndE-ValueType
PDB:3FQJ|A 2 48 1e-11 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000180043
SMART Domains Protein: ENSMUSP00000137234
Gene: ENSMUSG00000040482

DomainStartEndE-ValueType
low complexity region 168 184 N/A INTRINSIC
Pfam:RAI1 235 302 2e-25 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. This gene encodes a DEAD box protein, which is a human homologue of yeast SKI2 and may be involved in antiviral activity by blocking translation of poly(A) deficient mRNAs. This gene is located in the class III region of the major histocompatibility complex. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit embryonic lethality at E6. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017D01Rik A G 19: 11,110,361 F69L possibly damaging Het
1700123L14Rik A C 6: 96,165,392 L224V probably benign Het
Actrt3 T C 3: 30,598,207 K246R probably benign Het
Adam23 T A 1: 63,545,462 V343D probably damaging Het
Ak2 T C 4: 128,999,212 S55P probably damaging Het
Ank2 G A 3: 126,946,128 Q2036* probably null Het
Ano10 A G 9: 122,275,531 I40T probably benign Het
Aoc2 T A 11: 101,326,179 C363S possibly damaging Het
Aplp2 A T 9: 31,157,781 V584E possibly damaging Het
Arhgap32 A T 9: 32,256,967 T749S probably benign Het
Atm A T 9: 53,513,127 F625I probably damaging Het
Atr T C 9: 95,942,713 L2387P probably damaging Het
Barhl1 C T 2: 28,909,791 G274D probably damaging Het
Bcl2a1a A T 9: 88,957,292 D81V probably damaging Het
Ccdc63 T G 5: 122,113,204 D381A possibly damaging Het
Col12a1 A G 9: 79,703,296 probably null Het
Crat C T 2: 30,404,565 R497Q probably benign Het
Cyp4b1 T A 4: 115,628,687 D351V probably damaging Het
D130043K22Rik A G 13: 24,872,370 S562G probably damaging Het
D430042O09Rik G T 7: 125,870,666 V1436L probably damaging Het
Dmbt1 C T 7: 131,088,751 Q905* probably null Het
Dnajc21 A C 15: 10,462,295 Y81* probably null Het
Dnali1 T C 4: 125,065,538 T21A probably benign Het
Dpp8 A T 9: 65,078,782 L851F probably damaging Het
Dpt T C 1: 164,818,908 Y149H probably benign Het
Ep300 T C 15: 81,628,426 V983A unknown Het
Faf1 C T 4: 109,925,957 R549C probably damaging Het
Gcm1 A G 9: 78,064,467 N230S possibly damaging Het
Gm10803 T A 2: 93,564,168 I95N probably damaging Het
Hectd4 T A 5: 121,318,735 I721N possibly damaging Het
Hsp90ab1 T C 17: 45,570,271 H315R probably damaging Het
Igkv10-95 T A 6: 68,680,756 S85R possibly damaging Het
Kcnq5 T C 1: 21,402,321 T901A probably benign Het
Kremen1 C T 11: 5,194,964 V471M possibly damaging Het
Lama2 C A 10: 27,104,261 D1853Y possibly damaging Het
Lrif1 A G 3: 106,731,901 T76A probably benign Het
Lrrtm2 T A 18: 35,212,765 I495F possibly damaging Het
Ltbr G T 6: 125,307,241 Q413K probably benign Het
Myrfl T A 10: 116,828,997 Y376F probably damaging Het
Nup98 G T 7: 102,176,389 N414K probably benign Het
Nynrin A G 14: 55,871,584 T1383A probably damaging Het
Olfr1106 A T 2: 87,049,134 I34N probably benign Het
Olfr1211 G A 2: 88,929,805 P170L probably damaging Het
Olfr784 T A 10: 129,388,032 I133N probably damaging Het
Olfr845 C A 9: 19,339,273 T271K possibly damaging Het
Olfr915 G T 9: 38,646,895 P210T possibly damaging Het
Pcdhb5 T A 18: 37,322,372 S602T possibly damaging Het
Sall3 A G 18: 80,974,530 F61S probably benign Het
Scube1 G T 15: 83,721,887 C61* probably null Het
Sec31b T C 19: 44,543,323 D49G probably damaging Het
Slc19a3 C T 1: 83,022,748 V183M possibly damaging Het
Slc41a2 T C 10: 83,316,789 probably benign Het
Sphk2 C A 7: 45,712,507 V169L probably damaging Het
Synpo C A 18: 60,596,277 R951L probably damaging Het
Tbc1d9b G A 11: 50,170,716 C1017Y probably damaging Het
Tmtc4 C A 14: 122,978,151 V28F probably benign Het
Tprkb A G 6: 85,928,827 I165V probably benign Het
Ttc23l T A 15: 10,533,708 I250F probably damaging Het
Ube3c TTCTCTC TTCTCTCTCTC 5: 29,637,629 probably benign Het
Ubr3 G A 2: 69,991,503 V1370I probably damaging Het
Ush2a A G 1: 188,728,109 probably null Het
Usp9y T C Y: 1,384,451 Y689C probably damaging Het
Vmn1r56 A T 7: 5,195,896 Y241N probably damaging Het
Vmn2r6 T C 3: 64,565,262 T13A probably benign Het
Vmn2r92 T A 17: 18,166,766 N122K probably benign Het
Vps9d1 A G 8: 123,250,717 F131S probably damaging Het
Vwa8 A C 14: 78,982,234 probably null Het
Zbtb41 T A 1: 139,424,057 Y303N probably benign Het
Zbtb5 T C 4: 44,993,678 T569A probably benign Het
Zcchc11 T C 4: 108,479,346 V89A probably benign Het
Zfp111 A G 7: 24,198,600 S530P possibly damaging Het
Other mutations in Skiv2l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00096:Skiv2l APN 17 34839548 missense probably damaging 1.00
IGL00338:Skiv2l APN 17 34846667 missense probably damaging 0.99
IGL01284:Skiv2l APN 17 34839688 unclassified probably benign
IGL01308:Skiv2l APN 17 34840634 missense probably benign 0.19
IGL01874:Skiv2l APN 17 34841209 missense probably benign
IGL02114:Skiv2l APN 17 34841116 missense probably damaging 0.97
IGL02208:Skiv2l APN 17 34841675 missense probably damaging 0.99
IGL02274:Skiv2l APN 17 34845863 missense probably damaging 1.00
IGL02729:Skiv2l APN 17 34839605 missense possibly damaging 0.63
IGL02839:Skiv2l APN 17 34847798 missense probably benign
R0325:Skiv2l UTSW 17 34844815 missense possibly damaging 0.50
R1102:Skiv2l UTSW 17 34840106 missense probably benign 0.28
R1294:Skiv2l UTSW 17 34841064 splice site probably null
R1513:Skiv2l UTSW 17 34847444 missense probably damaging 1.00
R1557:Skiv2l UTSW 17 34848422 missense probably damaging 1.00
R1747:Skiv2l UTSW 17 34847806 missense probably benign 0.02
R2401:Skiv2l UTSW 17 34840385 missense probably benign
R3162:Skiv2l UTSW 17 34847813 nonsense probably null
R3162:Skiv2l UTSW 17 34847813 nonsense probably null
R3695:Skiv2l UTSW 17 34847912 missense probably damaging 1.00
R3700:Skiv2l UTSW 17 34849903 missense probably benign
R4654:Skiv2l UTSW 17 34849946 missense probably damaging 1.00
R4736:Skiv2l UTSW 17 34848197 missense possibly damaging 0.91
R4835:Skiv2l UTSW 17 34842921 missense possibly damaging 0.66
R5014:Skiv2l UTSW 17 34847425 missense probably benign 0.00
R5181:Skiv2l UTSW 17 34844826 missense probably benign 0.44
R5223:Skiv2l UTSW 17 34845166 critical splice donor site probably null
R5417:Skiv2l UTSW 17 34846598 missense probably damaging 0.98
R5623:Skiv2l UTSW 17 34847432 missense probably benign 0.00
R5878:Skiv2l UTSW 17 34846117 missense possibly damaging 0.83
R5979:Skiv2l UTSW 17 34841463 missense probably benign 0.01
R6412:Skiv2l UTSW 17 34840300 missense possibly damaging 0.92
R6501:Skiv2l UTSW 17 34844436 missense possibly damaging 0.95
R6532:Skiv2l UTSW 17 34844743 missense probably damaging 1.00
R6730:Skiv2l UTSW 17 34845190 nonsense probably null
R6732:Skiv2l UTSW 17 34845190 nonsense probably null
R6741:Skiv2l UTSW 17 34845190 nonsense probably null
R6742:Skiv2l UTSW 17 34845190 nonsense probably null
R6769:Skiv2l UTSW 17 34845190 nonsense probably null
R6771:Skiv2l UTSW 17 34845190 nonsense probably null
R7022:Skiv2l UTSW 17 34845207 missense possibly damaging 0.88
R7096:Skiv2l UTSW 17 34841470 missense probably benign
R7178:Skiv2l UTSW 17 34839464 missense probably benign
R7315:Skiv2l UTSW 17 34841169 missense probably benign 0.00
R7677:Skiv2l UTSW 17 34848164 missense probably benign 0.03
R7796:Skiv2l UTSW 17 34844418 missense probably damaging 1.00
Z1176:Skiv2l UTSW 17 34841546 missense not run
Predicted Primers PCR Primer
(F):5'- AGAGAGATTTCAGCCCATTCAC -3'
(R):5'- GGTGAGCAACGTAGCTGTTG -3'

Sequencing Primer
(F):5'- TCACAGACTCCATGATGCGTCG -3'
(R):5'- CAGTCTGGGCTGGCCAG -3'
Posted On2019-10-24