Incidental Mutation 'R7584:Synpo'
ID587003
Institutional Source Beutler Lab
Gene Symbol Synpo
Ensembl Gene ENSMUSG00000043079
Gene Namesynaptopodin
Synonyms9030217H17Rik, 9330140I15Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.188) question?
Stock #R7584 (G1)
Quality Score109.008
Status Not validated
Chromosome18
Chromosomal Location60593973-60660142 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 60596277 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 951 (R951L)
Ref Sequence ENSEMBL: ENSMUSP00000115355 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056533] [ENSMUST00000097566] [ENSMUST00000115318] [ENSMUST00000130044] [ENSMUST00000130360] [ENSMUST00000143275] [ENSMUST00000155195]
Predicted Effect probably benign
Transcript: ENSMUST00000056533
SMART Domains Protein: ENSMUSP00000063108
Gene: ENSMUSG00000049173

DomainStartEndE-ValueType
Pfam:Calsarcin 1 244 1.6e-36 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000097566
AA Change: R752L

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000095174
Gene: ENSMUSG00000043079
AA Change: R752L

DomainStartEndE-ValueType
low complexity region 78 90 N/A INTRINSIC
low complexity region 328 341 N/A INTRINSIC
low complexity region 428 446 N/A INTRINSIC
low complexity region 571 600 N/A INTRINSIC
low complexity region 607 628 N/A INTRINSIC
low complexity region 714 741 N/A INTRINSIC
low complexity region 769 782 N/A INTRINSIC
low complexity region 786 811 N/A INTRINSIC
low complexity region 830 846 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115318
SMART Domains Protein: ENSMUSP00000110973
Gene: ENSMUSG00000043079

DomainStartEndE-ValueType
low complexity region 78 90 N/A INTRINSIC
low complexity region 328 341 N/A INTRINSIC
low complexity region 428 446 N/A INTRINSIC
low complexity region 571 600 N/A INTRINSIC
low complexity region 607 628 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000130044
AA Change: R752L

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000121756
Gene: ENSMUSG00000043079
AA Change: R752L

DomainStartEndE-ValueType
low complexity region 78 90 N/A INTRINSIC
low complexity region 328 341 N/A INTRINSIC
low complexity region 428 446 N/A INTRINSIC
low complexity region 571 600 N/A INTRINSIC
low complexity region 607 628 N/A INTRINSIC
low complexity region 714 741 N/A INTRINSIC
low complexity region 769 782 N/A INTRINSIC
low complexity region 786 811 N/A INTRINSIC
low complexity region 830 846 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000130360
AA Change: R951L

PolyPhen 2 Score 0.958 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000115355
Gene: ENSMUSG00000043079
AA Change: R951L

DomainStartEndE-ValueType
low complexity region 33 43 N/A INTRINSIC
low complexity region 208 232 N/A INTRINSIC
low complexity region 317 329 N/A INTRINSIC
low complexity region 567 580 N/A INTRINSIC
low complexity region 667 685 N/A INTRINSIC
low complexity region 810 839 N/A INTRINSIC
low complexity region 846 867 N/A INTRINSIC
low complexity region 913 940 N/A INTRINSIC
low complexity region 968 981 N/A INTRINSIC
low complexity region 985 1010 N/A INTRINSIC
low complexity region 1029 1045 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000143275
SMART Domains Protein: ENSMUSP00000125272
Gene: ENSMUSG00000043079

DomainStartEndE-ValueType
low complexity region 33 43 N/A INTRINSIC
low complexity region 208 232 N/A INTRINSIC
low complexity region 317 329 N/A INTRINSIC
low complexity region 567 580 N/A INTRINSIC
low complexity region 667 685 N/A INTRINSIC
low complexity region 810 839 N/A INTRINSIC
low complexity region 846 867 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000155195
SMART Domains Protein: ENSMUSP00000117897
Gene: ENSMUSG00000043079

DomainStartEndE-ValueType
low complexity region 78 90 N/A INTRINSIC
low complexity region 328 341 N/A INTRINSIC
low complexity region 428 446 N/A INTRINSIC
low complexity region 571 600 N/A INTRINSIC
low complexity region 607 628 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Synaptopodin is an actin-associated protein that may play a role in actin-based cell shape and motility. The name synaptopodin derives from the protein's associations with postsynaptic densities and dendritic spines and with renal podocytes (Mundel et al., 1997 [PubMed 9314539]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene display abnormalities in telencephalic neurons, reduced long term potentiation, and behavioral abnormalities including hypoactivity, reduced anxiety, and learning deficiencies. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017D01Rik A G 19: 11,110,361 F69L possibly damaging Het
1700123L14Rik A C 6: 96,165,392 L224V probably benign Het
Actrt3 T C 3: 30,598,207 K246R probably benign Het
Adam23 T A 1: 63,545,462 V343D probably damaging Het
Ak2 T C 4: 128,999,212 S55P probably damaging Het
Ank2 G A 3: 126,946,128 Q2036* probably null Het
Ano10 A G 9: 122,275,531 I40T probably benign Het
Aoc2 T A 11: 101,326,179 C363S possibly damaging Het
Aplp2 A T 9: 31,157,781 V584E possibly damaging Het
Arhgap32 A T 9: 32,256,967 T749S probably benign Het
Atm A T 9: 53,513,127 F625I probably damaging Het
Atr T C 9: 95,942,713 L2387P probably damaging Het
Barhl1 C T 2: 28,909,791 G274D probably damaging Het
Bcl2a1a A T 9: 88,957,292 D81V probably damaging Het
Ccdc63 T G 5: 122,113,204 D381A possibly damaging Het
Col12a1 A G 9: 79,703,296 probably null Het
Crat C T 2: 30,404,565 R497Q probably benign Het
Cyp4b1 T A 4: 115,628,687 D351V probably damaging Het
D130043K22Rik A G 13: 24,872,370 S562G probably damaging Het
D430042O09Rik G T 7: 125,870,666 V1436L probably damaging Het
Dmbt1 C T 7: 131,088,751 Q905* probably null Het
Dnajc21 A C 15: 10,462,295 Y81* probably null Het
Dnali1 T C 4: 125,065,538 T21A probably benign Het
Dpp8 A T 9: 65,078,782 L851F probably damaging Het
Dpt T C 1: 164,818,908 Y149H probably benign Het
Ep300 T C 15: 81,628,426 V983A unknown Het
Faf1 C T 4: 109,925,957 R549C probably damaging Het
Gcm1 A G 9: 78,064,467 N230S possibly damaging Het
Gm10803 T A 2: 93,564,168 I95N probably damaging Het
Hectd4 T A 5: 121,318,735 I721N possibly damaging Het
Hsp90ab1 T C 17: 45,570,271 H315R probably damaging Het
Igkv10-95 T A 6: 68,680,756 S85R possibly damaging Het
Kcnq5 T C 1: 21,402,321 T901A probably benign Het
Kremen1 C T 11: 5,194,964 V471M possibly damaging Het
Lama2 C A 10: 27,104,261 D1853Y possibly damaging Het
Lrif1 A G 3: 106,731,901 T76A probably benign Het
Lrrtm2 T A 18: 35,212,765 I495F possibly damaging Het
Ltbr G T 6: 125,307,241 Q413K probably benign Het
Myrfl T A 10: 116,828,997 Y376F probably damaging Het
Nup98 G T 7: 102,176,389 N414K probably benign Het
Nynrin A G 14: 55,871,584 T1383A probably damaging Het
Olfr1106 A T 2: 87,049,134 I34N probably benign Het
Olfr1211 G A 2: 88,929,805 P170L probably damaging Het
Olfr784 T A 10: 129,388,032 I133N probably damaging Het
Olfr845 C A 9: 19,339,273 T271K possibly damaging Het
Olfr915 G T 9: 38,646,895 P210T possibly damaging Het
Pcdhb5 T A 18: 37,322,372 S602T possibly damaging Het
Sall3 A G 18: 80,974,530 F61S probably benign Het
Scube1 G T 15: 83,721,887 C61* probably null Het
Sec31b T C 19: 44,543,323 D49G probably damaging Het
Skiv2l A G 17: 34,841,675 I822T possibly damaging Het
Slc19a3 C T 1: 83,022,748 V183M possibly damaging Het
Slc41a2 T C 10: 83,316,789 probably benign Het
Sphk2 C A 7: 45,712,507 V169L probably damaging Het
Tbc1d9b G A 11: 50,170,716 C1017Y probably damaging Het
Tmtc4 C A 14: 122,978,151 V28F probably benign Het
Tprkb A G 6: 85,928,827 I165V probably benign Het
Ttc23l T A 15: 10,533,708 I250F probably damaging Het
Ube3c TTCTCTC TTCTCTCTCTC 5: 29,637,629 probably benign Het
Ubr3 G A 2: 69,991,503 V1370I probably damaging Het
Ush2a A G 1: 188,728,109 probably null Het
Usp9y T C Y: 1,384,451 Y689C probably damaging Het
Vmn1r56 A T 7: 5,195,896 Y241N probably damaging Het
Vmn2r6 T C 3: 64,565,262 T13A probably benign Het
Vmn2r92 T A 17: 18,166,766 N122K probably benign Het
Vps9d1 A G 8: 123,250,717 F131S probably damaging Het
Vwa8 A C 14: 78,982,234 probably null Het
Zbtb41 T A 1: 139,424,057 Y303N probably benign Het
Zbtb5 T C 4: 44,993,678 T569A probably benign Het
Zcchc11 T C 4: 108,479,346 V89A probably benign Het
Zfp111 A G 7: 24,198,600 S530P possibly damaging Het
Other mutations in Synpo
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00725:Synpo APN 18 60604077 missense probably damaging 1.00
IGL00976:Synpo APN 18 60603419 missense possibly damaging 0.74
IGL01808:Synpo APN 18 60602208 missense probably benign 0.01
IGL02116:Synpo APN 18 60603456 missense probably damaging 1.00
IGL02444:Synpo APN 18 60602430 missense probably damaging 1.00
IGL02838:Synpo APN 18 60603800 missense probably damaging 1.00
R0420:Synpo UTSW 18 60602418 missense probably damaging 0.97
R0650:Synpo UTSW 18 60602340 missense possibly damaging 0.83
R0790:Synpo UTSW 18 60603503 missense probably damaging 0.98
R1213:Synpo UTSW 18 60602453 missense possibly damaging 0.83
R1695:Synpo UTSW 18 60603387 missense probably benign 0.00
R1763:Synpo UTSW 18 60602784 missense probably damaging 1.00
R1920:Synpo UTSW 18 60603589 missense probably benign 0.00
R1921:Synpo UTSW 18 60603589 missense probably benign 0.00
R2133:Synpo UTSW 18 60602895 missense probably damaging 1.00
R3757:Synpo UTSW 18 60602990 missense probably damaging 1.00
R4796:Synpo UTSW 18 60604314 missense probably damaging 0.97
R4841:Synpo UTSW 18 60603612 missense probably damaging 0.99
R4842:Synpo UTSW 18 60603612 missense probably damaging 0.99
R4911:Synpo UTSW 18 60629864 utr 5 prime probably benign
R5091:Synpo UTSW 18 60602759 nonsense probably null
R5327:Synpo UTSW 18 60603846 missense possibly damaging 0.93
R5354:Synpo UTSW 18 60602231 critical splice donor site probably null
R5671:Synpo UTSW 18 60595950 missense probably damaging 0.99
R5868:Synpo UTSW 18 60604046 missense probably damaging 1.00
R6007:Synpo UTSW 18 60603615 missense probably benign 0.35
R7266:Synpo UTSW 18 60629559 missense probably benign 0.00
R7472:Synpo UTSW 18 60629823 missense probably benign 0.00
R7509:Synpo UTSW 18 60603494 missense probably damaging 1.00
R7554:Synpo UTSW 18 60603333 missense probably benign 0.21
R7615:Synpo UTSW 18 60604475 missense probably damaging 1.00
R7633:Synpo UTSW 18 60603428 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAAGCAGCTCCACGGAAGTTAC -3'
(R):5'- GGAGGACCTGACACTAAACC -3'

Sequencing Primer
(F):5'- TCCACGGAAGTTACGGGCAG -3'
(R):5'- TGACACTAAACCTTCCCCGTC -3'
Posted On2019-10-24