Incidental Mutation 'R7585:Fdps'
ID587027
Institutional Source Beutler Lab
Gene Symbol Fdps
Ensembl Gene ENSMUSG00000059743
Gene Namefarnesyl diphosphate synthetase
Synonyms6030492I17Rik, Fdpsl1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.965) question?
Stock #R7585 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location89093588-89101959 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 89093806 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 300 (R300L)
Ref Sequence ENSEMBL: ENSMUSP00000080531 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052539] [ENSMUST00000081848] [ENSMUST00000090929] [ENSMUST00000166687] [ENSMUST00000196043] [ENSMUST00000196223] [ENSMUST00000196254] [ENSMUST00000196709] [ENSMUST00000196921] [ENSMUST00000199668] [ENSMUST00000200659]
Predicted Effect probably benign
Transcript: ENSMUST00000052539
SMART Domains Protein: ENSMUSP00000056640
Gene: ENSMUSG00000041263

DomainStartEndE-ValueType
low complexity region 95 117 N/A INTRINSIC
low complexity region 149 165 N/A INTRINSIC
low complexity region 374 383 N/A INTRINSIC
low complexity region 389 402 N/A INTRINSIC
low complexity region 429 440 N/A INTRINSIC
low complexity region 577 588 N/A INTRINSIC
RUN 589 657 2.75e-16 SMART
low complexity region 669 683 N/A INTRINSIC
low complexity region 702 714 N/A INTRINSIC
low complexity region 753 770 N/A INTRINSIC
SH3 838 893 4.32e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000081848
AA Change: R300L

PolyPhen 2 Score 0.175 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000080531
Gene: ENSMUSG00000059743
AA Change: R300L

DomainStartEndE-ValueType
Pfam:polyprenyl_synt 47 313 2e-82 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000090929
SMART Domains Protein: ENSMUSP00000088447
Gene: ENSMUSG00000041263

DomainStartEndE-ValueType
low complexity region 95 117 N/A INTRINSIC
low complexity region 149 165 N/A INTRINSIC
internal_repeat_1 195 244 5.11e-5 PROSPERO
internal_repeat_1 247 292 5.11e-5 PROSPERO
low complexity region 374 383 N/A INTRINSIC
low complexity region 389 402 N/A INTRINSIC
low complexity region 429 440 N/A INTRINSIC
low complexity region 463 479 N/A INTRINSIC
low complexity region 522 543 N/A INTRINSIC
low complexity region 546 584 N/A INTRINSIC
low complexity region 714 725 N/A INTRINSIC
RUN 726 794 2.75e-16 SMART
low complexity region 806 820 N/A INTRINSIC
low complexity region 839 851 N/A INTRINSIC
low complexity region 890 907 N/A INTRINSIC
SH3 975 1030 4.32e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000166687
SMART Domains Protein: ENSMUSP00000130477
Gene: ENSMUSG00000041263

DomainStartEndE-ValueType
low complexity region 115 126 N/A INTRINSIC
RUN 127 195 2.75e-16 SMART
low complexity region 207 221 N/A INTRINSIC
low complexity region 240 252 N/A INTRINSIC
low complexity region 291 308 N/A INTRINSIC
SH3 376 431 4.32e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000196043
SMART Domains Protein: ENSMUSP00000142622
Gene: ENSMUSG00000041263

DomainStartEndE-ValueType
PDB:4GIW|B 8 79 5e-45 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000196223
SMART Domains Protein: ENSMUSP00000143662
Gene: ENSMUSG00000041263

DomainStartEndE-ValueType
Pfam:RUN 61 166 2.1e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000196254
AA Change: R222L

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000142669
Gene: ENSMUSG00000059743
AA Change: R222L

DomainStartEndE-ValueType
Pfam:polyprenyl_synt 1 238 3.6e-60 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000196709
AA Change: R300L

PolyPhen 2 Score 0.175 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000142770
Gene: ENSMUSG00000059743
AA Change: R300L

DomainStartEndE-ValueType
Pfam:polyprenyl_synt 44 316 8.7e-84 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000196921
SMART Domains Protein: ENSMUSP00000142704
Gene: ENSMUSG00000059743

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:polyprenyl_synt 111 226 7.9e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000199668
SMART Domains Protein: ENSMUSP00000142393
Gene: ENSMUSG00000059743

DomainStartEndE-ValueType
Pfam:polyprenyl_synt 44 121 3.2e-22 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000200659
AA Change: R322L

PolyPhen 2 Score 0.603 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000142694
Gene: ENSMUSG00000105204
AA Change: R322L

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:polyprenyl_synt 111 334 3.2e-55 PFAM
low complexity region 548 559 N/A INTRINSIC
RUN 560 628 9.3e-19 SMART
low complexity region 640 654 N/A INTRINSIC
low complexity region 673 685 N/A INTRINSIC
low complexity region 724 741 N/A INTRINSIC
SH3 809 862 2.8e-10 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme that catalyzes the production of geranyl pyrophosphate and farnesyl pyrophosphate from isopentenyl pyrophosphate and dimethylallyl pyrophosphate. The resulting product, farnesyl pyrophosphate, is a key intermediate in cholesterol and sterol biosynthesis, a substrate for protein farnesylation and geranylgeranylation, and a ligand or agonist for certain hormone receptors and growth receptors. Drugs that inhibit this enzyme prevent the post-translational modifications of small GTPases and have been used to treat diseases related to bone resorption. Multiple pseudogenes have been found on chromosomes 1, 7, 14, 15, 21 and X. Multiple transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Oct 2008]
Allele List at MGI
Other mutations in this stock
Total: 105 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700034J05Rik T C 6: 146,953,353 T64A probably benign Het
A930009A15Rik T A 10: 115,578,325 V52D unknown Het
Acacb A G 5: 114,246,012 I2201V probably damaging Het
Aco2 A C 15: 81,872,484 probably benign Het
Acod1 C T 14: 103,054,741 Q234* probably null Het
Actr6 T C 10: 89,725,796 S163G probably benign Het
Agmat T C 4: 141,749,745 V154A probably benign Het
Agrn T C 4: 156,170,674 N1584S probably benign Het
Alg6 A T 4: 99,738,134 S60C probably damaging Het
Ap5s1 T C 2: 131,212,562 F98L probably damaging Het
Atp6v1f G A 6: 29,467,928 V38I possibly damaging Het
B3gnt3 T C 8: 71,693,328 T186A probably damaging Het
Brpf1 T C 6: 113,315,046 V351A possibly damaging Het
Cacna1g A G 11: 94,473,542 S26P probably benign Het
Camta1 G A 4: 151,144,830 S515L probably damaging Het
Ccdc122 C A 14: 77,091,699 A64E probably damaging Het
Ccdc89 C A 7: 90,427,302 T240K possibly damaging Het
Cercam T C 2: 29,881,731 L521P probably damaging Het
Cfb T C 17: 34,857,761 N561S probably benign Het
Clk3 T C 9: 57,761,836 E159G probably damaging Het
Cntf A T 19: 12,764,223 L91* probably null Het
Cntn4 T A 6: 106,489,611 I158N probably damaging Het
Cog5 T A 12: 31,760,889 I194K probably damaging Het
Col22a1 T A 15: 71,892,205 D66V probably damaging Het
Crat C T 2: 30,404,565 R497Q probably benign Het
Csmd3 T C 15: 48,622,075 T145A possibly damaging Het
D130043K22Rik A G 13: 24,885,585 I876V probably benign Het
Dlec1 T C 9: 119,142,751 S1335P probably benign Het
Dnah5 A T 15: 28,401,868 T3392S probably benign Het
Dnal1 A G 12: 84,124,493 K21E probably benign Het
Dspp T C 5: 104,175,525 V178A possibly damaging Het
Dst A G 1: 34,114,015 D119G possibly damaging Het
Dyrk4 T A 6: 126,890,044 I342F probably damaging Het
Eif3b A G 5: 140,440,002 D649G probably damaging Het
Exoc7 T C 11: 116,300,298 D259G probably benign Het
Fancm T C 12: 65,106,247 V1159A possibly damaging Het
Fat3 T C 9: 15,998,262 D2148G probably benign Het
Gfm2 T C 13: 97,179,032 L736P probably benign Het
Gm11397 G T 13: 33,404,316 D295Y probably benign Het
Gm5538 C A 3: 59,743,722 D88E possibly damaging Het
Grin2b T A 6: 135,779,303 T475S probably damaging Het
H2-M3 T G 17: 37,270,708 L87R probably damaging Het
Hao1 T A 2: 134,501,156 I272F probably damaging Het
Hapln2 C T 3: 88,022,673 G299S probably damaging Het
Hdac3 A T 18: 37,945,355 I154N probably damaging Het
Herc1 A G 9: 66,445,547 D2105G probably damaging Het
Kcna2 T C 3: 107,105,342 F413S probably damaging Het
Kctd13 A G 7: 126,929,286 T78A possibly damaging Het
Kif20a A G 18: 34,625,538 D20G probably benign Het
Kif26b A T 1: 178,916,496 I1386F probably benign Het
Klc4 T A 17: 46,631,884 M585L probably benign Het
Lrp4 A G 2: 91,492,588 Y1139C probably damaging Het
Lrp5 A T 19: 3,604,094 I1111N possibly damaging Het
Lrriq1 A T 10: 103,214,946 D648E possibly damaging Het
Mfsd7a T C 5: 108,448,819 T16A probably benign Het
Mmp2 G A 8: 92,836,936 G346D probably damaging Het
Mrgpra4 T A 7: 47,981,629 I75L probably benign Het
Muc4 T A 16: 32,765,702 V537D Het
Myh2 T A 11: 67,179,411 probably null Het
Myrf T C 19: 10,216,727 T487A probably damaging Het
Nalcn A T 14: 123,515,638 L312H probably damaging Het
Nop14 G A 5: 34,644,780 P560L probably damaging Het
Nufip1 C G 14: 76,110,987 P19A probably benign Het
Olfr1263 A T 2: 90,015,049 I40F probably damaging Het
Olfr1274-ps T A 2: 90,401,023 Y121N probably damaging Het
Olfr1415 A G 1: 92,491,320 V145A probably benign Het
Olfr293 T C 7: 86,664,672 *337Q probably null Het
Olfr503 C A 7: 108,545,391 P289T probably damaging Het
Olfr611 C A 7: 103,517,959 V142L possibly damaging Het
Olfr633 A G 7: 103,947,400 N278S probably benign Het
Olfr869 T C 9: 20,129,011 Het
Oosp3 G T 19: 11,700,958 M99I probably benign Het
Panx2 A G 15: 89,067,966 K212R probably damaging Het
Paxip1 A C 5: 27,772,004 H353Q unknown Het
Pbx4 C A 8: 69,832,825 D39E probably damaging Het
Phc2 G A 4: 128,711,139 A223T probably benign Het
Plcl1 A G 1: 55,406,449 D21G probably benign Het
Plec G A 15: 76,173,432 R4102W probably damaging Het
Plekhh2 A G 17: 84,577,180 Y774C probably benign Het
Polr2a A T 11: 69,740,002 Y1197N probably damaging Het
Psmg4 A T 13: 34,163,212 H46L probably benign Het
Ptprk A G 10: 28,560,088 Y815C probably damaging Het
Qrich2 T C 11: 116,455,721 I1426V probably benign Het
Rbm43 T C 2: 51,926,751 D68G probably benign Het
Rgs6 T C 12: 83,106,870 S360P probably damaging Het
Rp1l1 T G 14: 64,030,139 L1058R probably damaging Het
Rreb1 A G 13: 37,893,898 S29G probably benign Het
Scube1 C A 15: 83,638,787 R284L possibly damaging Het
Slc13a3 T C 2: 165,430,322 Q267R probably benign Het
Slc5a1 A T 5: 33,160,944 N647I probably damaging Het
Sphk2 A T 7: 45,711,582 S333T probably benign Het
Sptan1 A G 2: 30,000,056 D1050G probably benign Het
Tdo2 G T 3: 81,962,758 A269E probably damaging Het
Tnc A T 4: 64,020,411 C64S probably damaging Het
Trim47 T A 11: 116,107,557 E360D probably damaging Het
Trp53i13 T A 11: 77,508,303 T374S possibly damaging Het
Try5 A G 6: 41,311,814 L157P probably benign Het
Ttn A T 2: 76,747,832 V24239D probably damaging Het
Ttn T C 2: 76,943,323 Y2318C unknown Het
Txn1 T C 4: 57,945,199 D68G possibly damaging Het
Upf3a A G 8: 13,787,418 D121G probably damaging Het
Vmn2r114 T C 17: 23,291,265 Y747C probably damaging Het
Vmn2r68 A G 7: 85,232,379 W498R probably damaging Het
Vwa8 A C 14: 78,982,234 probably null Het
Zp2 A T 7: 120,133,944 F591L probably damaging Het
Other mutations in Fdps
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01361:Fdps APN 3 89094442 splice site probably benign
IGL01364:Fdps APN 3 89094270 nonsense probably null
broadside UTSW 3 89100761 missense probably damaging 1.00
R0245:Fdps UTSW 3 89093771 missense possibly damaging 0.84
R0385:Fdps UTSW 3 89094894 missense probably damaging 1.00
R1674:Fdps UTSW 3 89100730 missense probably benign 0.33
R1820:Fdps UTSW 3 89095043 missense probably benign
R4467:Fdps UTSW 3 89100786 missense possibly damaging 0.71
R5106:Fdps UTSW 3 89099403 missense probably damaging 0.99
R5700:Fdps UTSW 3 89095649 missense probably damaging 1.00
R6128:Fdps UTSW 3 89099433 missense possibly damaging 0.77
R6791:Fdps UTSW 3 89095352 critical splice donor site probably null
R6800:Fdps UTSW 3 89100761 missense probably damaging 1.00
R6812:Fdps UTSW 3 89094476 missense possibly damaging 0.51
R6927:Fdps UTSW 3 89093651 missense probably benign 0.41
R7599:Fdps UTSW 3 89099386 missense probably benign 0.05
R7691:Fdps UTSW 3 89099367 missense probably benign 0.01
R7709:Fdps UTSW 3 89101090 missense probably damaging 0.97
R8035:Fdps UTSW 3 89095476 missense probably benign 0.04
R8132:Fdps UTSW 3 89099386 nonsense probably null
R8297:Fdps UTSW 3 89093741 missense probably damaging 0.99
R8323:Fdps UTSW 3 89095389 missense possibly damaging 0.93
X0060:Fdps UTSW 3 89094314 missense possibly damaging 0.54
Predicted Primers PCR Primer
(F):5'- CCAATTCCGGGGTCACTTTC -3'
(R):5'- CAATAACTCAGCCGTGTCAAG -3'

Sequencing Primer
(F):5'- GGGTCACTTTCTCCGTTTGTAGATC -3'
(R):5'- GAGCCAATACCTGAACTTTGGGC -3'
Posted On2019-10-24