Incidental Mutation 'R7585:Acacb'
ID587041
Institutional Source Beutler Lab
Gene Symbol Acacb
Ensembl Gene ENSMUSG00000042010
Gene Nameacetyl-Coenzyme A carboxylase beta
SynonymsAcc2, Accb
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7585 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location114146535-114250761 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 114246012 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 2201 (I2201V)
Ref Sequence ENSEMBL: ENSMUSP00000031583 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031583] [ENSMUST00000102582]
Predicted Effect probably damaging
Transcript: ENSMUST00000031583
AA Change: I2201V

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000031583
Gene: ENSMUSG00000042010
AA Change: I2201V

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
low complexity region 38 60 N/A INTRINSIC
Pfam:CPSase_L_chain 249 369 2.1e-32 PFAM
Pfam:CPSase_L_D2 405 606 3.3e-52 PFAM
Pfam:ATP-grasp_4 413 576 2.1e-9 PFAM
Biotin_carb_C 640 747 9.54e-26 SMART
Pfam:Biotin_lipoyl 885 951 1.9e-17 PFAM
Pfam:ACC_central 952 1678 2.2e-290 PFAM
Pfam:Carboxyl_trans 1770 2324 2.3e-181 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000102582
AA Change: I2201V

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000099642
Gene: ENSMUSG00000042010
AA Change: I2201V

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
low complexity region 38 60 N/A INTRINSIC
Pfam:CPSase_L_chain 249 369 8.2e-29 PFAM
Pfam:CPSase_L_D2 405 606 3.8e-52 PFAM
Pfam:ATP-grasp_4 409 576 1.4e-12 PFAM
Biotin_carb_C 640 747 9.54e-26 SMART
Pfam:Biotin_lipoyl 885 951 9.1e-17 PFAM
Pfam:ACC_central 952 1678 2.3e-250 PFAM
Pfam:Carboxyl_trans 1770 2324 4.8e-172 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Acetyl-CoA carboxylase (ACC) is a complex multifunctional enzyme system. ACC is a biotin-containing enzyme which catalyzes the carboxylation of acetyl-CoA to malonyl-CoA, the rate-limiting step in fatty acid synthesis. ACC-beta is thought to control fatty acid oxidation by means of the ability of malonyl-CoA to inhibit carnitine-palmitoyl-CoA transferase I, the rate-limiting step in fatty acid uptake and oxidation by mitochondria. ACC-beta may be involved in the regulation of fatty acid oxidation, rather than fatty acid biosynthesis. There is evidence for the presence of two ACC-beta isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted null mutation are viable, fertile and overtly normal but exhibit high levels of fatty acid oxidation, as well as reduced fat accumulation in their adipose tissue and liver, and decreased storage of glycogen in their liver. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 105 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700034J05Rik T C 6: 146,953,353 T64A probably benign Het
A930009A15Rik T A 10: 115,578,325 V52D unknown Het
Aco2 A C 15: 81,872,484 probably benign Het
Acod1 C T 14: 103,054,741 Q234* probably null Het
Actr6 T C 10: 89,725,796 S163G probably benign Het
Agmat T C 4: 141,749,745 V154A probably benign Het
Agrn T C 4: 156,170,674 N1584S probably benign Het
Alg6 A T 4: 99,738,134 S60C probably damaging Het
Ap5s1 T C 2: 131,212,562 F98L probably damaging Het
Atp6v1f G A 6: 29,467,928 V38I possibly damaging Het
B3gnt3 T C 8: 71,693,328 T186A probably damaging Het
Brpf1 T C 6: 113,315,046 V351A possibly damaging Het
Cacna1g A G 11: 94,473,542 S26P probably benign Het
Camta1 G A 4: 151,144,830 S515L probably damaging Het
Ccdc122 C A 14: 77,091,699 A64E probably damaging Het
Ccdc89 C A 7: 90,427,302 T240K possibly damaging Het
Cercam T C 2: 29,881,731 L521P probably damaging Het
Cfb T C 17: 34,857,761 N561S probably benign Het
Clk3 T C 9: 57,761,836 E159G probably damaging Het
Cntf A T 19: 12,764,223 L91* probably null Het
Cntn4 T A 6: 106,489,611 I158N probably damaging Het
Cog5 T A 12: 31,760,889 I194K probably damaging Het
Col22a1 T A 15: 71,892,205 D66V probably damaging Het
Crat C T 2: 30,404,565 R497Q probably benign Het
Csmd3 T C 15: 48,622,075 T145A possibly damaging Het
D130043K22Rik A G 13: 24,885,585 I876V probably benign Het
Dlec1 T C 9: 119,142,751 S1335P probably benign Het
Dnah5 A T 15: 28,401,868 T3392S probably benign Het
Dnal1 A G 12: 84,124,493 K21E probably benign Het
Dspp T C 5: 104,175,525 V178A possibly damaging Het
Dst A G 1: 34,114,015 D119G possibly damaging Het
Dyrk4 T A 6: 126,890,044 I342F probably damaging Het
Eif3b A G 5: 140,440,002 D649G probably damaging Het
Exoc7 T C 11: 116,300,298 D259G probably benign Het
Fancm T C 12: 65,106,247 V1159A possibly damaging Het
Fat3 T C 9: 15,998,262 D2148G probably benign Het
Fdps C A 3: 89,093,806 R300L probably benign Het
Gfm2 T C 13: 97,179,032 L736P probably benign Het
Gm11397 G T 13: 33,404,316 D295Y probably benign Het
Gm5538 C A 3: 59,743,722 D88E possibly damaging Het
Grin2b T A 6: 135,779,303 T475S probably damaging Het
H2-M3 T G 17: 37,270,708 L87R probably damaging Het
Hao1 T A 2: 134,501,156 I272F probably damaging Het
Hapln2 C T 3: 88,022,673 G299S probably damaging Het
Hdac3 A T 18: 37,945,355 I154N probably damaging Het
Herc1 A G 9: 66,445,547 D2105G probably damaging Het
Kcna2 T C 3: 107,105,342 F413S probably damaging Het
Kctd13 A G 7: 126,929,286 T78A possibly damaging Het
Kif20a A G 18: 34,625,538 D20G probably benign Het
Kif26b A T 1: 178,916,496 I1386F probably benign Het
Klc4 T A 17: 46,631,884 M585L probably benign Het
Lrp4 A G 2: 91,492,588 Y1139C probably damaging Het
Lrp5 A T 19: 3,604,094 I1111N possibly damaging Het
Lrriq1 A T 10: 103,214,946 D648E possibly damaging Het
Mfsd7a T C 5: 108,448,819 T16A probably benign Het
Mmp2 G A 8: 92,836,936 G346D probably damaging Het
Mrgpra4 T A 7: 47,981,629 I75L probably benign Het
Muc4 T A 16: 32,765,702 V537D Het
Myh2 T A 11: 67,179,411 probably null Het
Myrf T C 19: 10,216,727 T487A probably damaging Het
Nalcn A T 14: 123,515,638 L312H probably damaging Het
Nop14 G A 5: 34,644,780 P560L probably damaging Het
Nufip1 C G 14: 76,110,987 P19A probably benign Het
Olfr1263 A T 2: 90,015,049 I40F probably damaging Het
Olfr1274-ps T A 2: 90,401,023 Y121N probably damaging Het
Olfr1415 A G 1: 92,491,320 V145A probably benign Het
Olfr293 T C 7: 86,664,672 *337Q probably null Het
Olfr503 C A 7: 108,545,391 P289T probably damaging Het
Olfr611 C A 7: 103,517,959 V142L possibly damaging Het
Olfr633 A G 7: 103,947,400 N278S probably benign Het
Olfr869 T C 9: 20,129,011 Het
Oosp3 G T 19: 11,700,958 M99I probably benign Het
Panx2 A G 15: 89,067,966 K212R probably damaging Het
Paxip1 A C 5: 27,772,004 H353Q unknown Het
Pbx4 C A 8: 69,832,825 D39E probably damaging Het
Phc2 G A 4: 128,711,139 A223T probably benign Het
Plcl1 A G 1: 55,406,449 D21G probably benign Het
Plec G A 15: 76,173,432 R4102W probably damaging Het
Plekhh2 A G 17: 84,577,180 Y774C probably benign Het
Polr2a A T 11: 69,740,002 Y1197N probably damaging Het
Psmg4 A T 13: 34,163,212 H46L probably benign Het
Ptprk A G 10: 28,560,088 Y815C probably damaging Het
Qrich2 T C 11: 116,455,721 I1426V probably benign Het
Rbm43 T C 2: 51,926,751 D68G probably benign Het
Rgs6 T C 12: 83,106,870 S360P probably damaging Het
Rp1l1 T G 14: 64,030,139 L1058R probably damaging Het
Rreb1 A G 13: 37,893,898 S29G probably benign Het
Scube1 C A 15: 83,638,787 R284L possibly damaging Het
Slc13a3 T C 2: 165,430,322 Q267R probably benign Het
Slc5a1 A T 5: 33,160,944 N647I probably damaging Het
Sphk2 A T 7: 45,711,582 S333T probably benign Het
Sptan1 A G 2: 30,000,056 D1050G probably benign Het
Tdo2 G T 3: 81,962,758 A269E probably damaging Het
Tnc A T 4: 64,020,411 C64S probably damaging Het
Trim47 T A 11: 116,107,557 E360D probably damaging Het
Trp53i13 T A 11: 77,508,303 T374S possibly damaging Het
Try5 A G 6: 41,311,814 L157P probably benign Het
Ttn A T 2: 76,747,832 V24239D probably damaging Het
Ttn T C 2: 76,943,323 Y2318C unknown Het
Txn1 T C 4: 57,945,199 D68G possibly damaging Het
Upf3a A G 8: 13,787,418 D121G probably damaging Het
Vmn2r114 T C 17: 23,291,265 Y747C probably damaging Het
Vmn2r68 A G 7: 85,232,379 W498R probably damaging Het
Vwa8 A C 14: 78,982,234 probably null Het
Zp2 A T 7: 120,133,944 F591L probably damaging Het
Other mutations in Acacb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00482:Acacb APN 5 114200289 missense probably damaging 1.00
IGL01291:Acacb APN 5 114225870 missense probably benign 0.03
IGL01301:Acacb APN 5 114246498 missense probably benign
IGL01633:Acacb APN 5 114218858 splice site probably benign
IGL01736:Acacb APN 5 114188442 missense possibly damaging 0.96
IGL01782:Acacb APN 5 114200520 missense probably damaging 1.00
IGL01924:Acacb APN 5 114223986 splice site probably benign
IGL01933:Acacb APN 5 114184190 splice site probably benign
IGL02028:Acacb APN 5 114166015 missense probably damaging 1.00
IGL02045:Acacb APN 5 114240660 missense possibly damaging 0.95
IGL02346:Acacb APN 5 114238699 missense probably damaging 1.00
IGL02421:Acacb APN 5 114223878 missense probably benign 0.00
IGL02445:Acacb APN 5 114245137 missense probably damaging 1.00
IGL02491:Acacb APN 5 114192105 missense probably damaging 1.00
IGL02598:Acacb APN 5 114246037 missense probably damaging 1.00
IGL02700:Acacb APN 5 114218881 missense probably damaging 1.00
IGL02730:Acacb APN 5 114166149 splice site probably benign
IGL03110:Acacb APN 5 114195234 missense probably damaging 0.96
IGL03125:Acacb APN 5 114204805 missense possibly damaging 0.49
IGL03263:Acacb APN 5 114213693 missense probably damaging 1.00
IGL03324:Acacb APN 5 114225854 nonsense probably null
ANU05:Acacb UTSW 5 114225870 missense probably benign 0.03
ANU18:Acacb UTSW 5 114246498 missense probably benign
BB001:Acacb UTSW 5 114245220 missense possibly damaging 0.63
BB011:Acacb UTSW 5 114245220 missense possibly damaging 0.63
I0000:Acacb UTSW 5 114238655 missense probably damaging 0.99
R0001:Acacb UTSW 5 114204833 splice site probably benign
R0219:Acacb UTSW 5 114232944 missense possibly damaging 0.79
R0234:Acacb UTSW 5 114209817 missense probably damaging 0.99
R0234:Acacb UTSW 5 114209817 missense probably damaging 0.99
R0278:Acacb UTSW 5 114233259 nonsense probably null
R0607:Acacb UTSW 5 114200301 missense probably damaging 1.00
R0964:Acacb UTSW 5 114229752 missense possibly damaging 0.64
R1116:Acacb UTSW 5 114210956 missense probably damaging 1.00
R1196:Acacb UTSW 5 114245092 missense probably benign 0.00
R1204:Acacb UTSW 5 114190153 missense probably damaging 1.00
R1387:Acacb UTSW 5 114200512 missense probably benign
R1415:Acacb UTSW 5 114165921 missense probably benign
R1475:Acacb UTSW 5 114195252 missense possibly damaging 0.87
R1497:Acacb UTSW 5 114196807 missense probably damaging 1.00
R1520:Acacb UTSW 5 114201940 missense possibly damaging 0.67
R1591:Acacb UTSW 5 114203423 missense possibly damaging 0.87
R1644:Acacb UTSW 5 114195285 missense probably damaging 1.00
R1732:Acacb UTSW 5 114190087 missense possibly damaging 0.63
R1783:Acacb UTSW 5 114209767 frame shift probably null
R1784:Acacb UTSW 5 114209767 frame shift probably null
R1834:Acacb UTSW 5 114235475 missense probably damaging 1.00
R1858:Acacb UTSW 5 114196709 missense probably benign 0.13
R1886:Acacb UTSW 5 114218959 missense probably damaging 1.00
R1901:Acacb UTSW 5 114165734 nonsense probably null
R1902:Acacb UTSW 5 114165734 nonsense probably null
R1903:Acacb UTSW 5 114165734 nonsense probably null
R1924:Acacb UTSW 5 114230720 missense possibly damaging 0.67
R1934:Acacb UTSW 5 114198282 missense probably benign 0.27
R2051:Acacb UTSW 5 114245890 missense probably damaging 1.00
R2132:Acacb UTSW 5 114209767 frame shift probably null
R2133:Acacb UTSW 5 114209767 frame shift probably null
R2260:Acacb UTSW 5 114216917 missense probably damaging 0.99
R2967:Acacb UTSW 5 114166070 missense possibly damaging 0.81
R3421:Acacb UTSW 5 114212636 splice site probably null
R3729:Acacb UTSW 5 114207348 missense probably damaging 0.99
R4206:Acacb UTSW 5 114213651 missense probably benign
R4245:Acacb UTSW 5 114230784 missense probably damaging 0.97
R4386:Acacb UTSW 5 114241921 critical splice acceptor site probably null
R4439:Acacb UTSW 5 114246496 missense possibly damaging 0.50
R4577:Acacb UTSW 5 114226831 missense probably damaging 1.00
R4658:Acacb UTSW 5 114200564 missense probably damaging 0.96
R4688:Acacb UTSW 5 114204763 missense probably benign 0.01
R4720:Acacb UTSW 5 114229914 missense possibly damaging 0.73
R4898:Acacb UTSW 5 114232938 missense probably benign 0.04
R5044:Acacb UTSW 5 114166027 missense probably benign 0.03
R5070:Acacb UTSW 5 114246028 missense possibly damaging 0.46
R5294:Acacb UTSW 5 114241952 missense probably damaging 1.00
R5350:Acacb UTSW 5 114244551 missense probably damaging 1.00
R5401:Acacb UTSW 5 114209853 missense possibly damaging 0.80
R5531:Acacb UTSW 5 114204706 missense possibly damaging 0.92
R5542:Acacb UTSW 5 114195737 missense probably damaging 1.00
R5751:Acacb UTSW 5 114230832 missense possibly damaging 0.79
R5821:Acacb UTSW 5 114184106 missense possibly damaging 0.69
R5893:Acacb UTSW 5 114229851 missense probably benign 0.01
R5911:Acacb UTSW 5 114232890 missense probably damaging 0.97
R5944:Acacb UTSW 5 114245980 missense probably damaging 1.00
R5973:Acacb UTSW 5 114226867 missense probably damaging 1.00
R6027:Acacb UTSW 5 114165600 missense probably benign 0.43
R6103:Acacb UTSW 5 114245881 missense probably damaging 1.00
R6139:Acacb UTSW 5 114212652 missense probably damaging 1.00
R6292:Acacb UTSW 5 114200251 missense probably damaging 1.00
R6368:Acacb UTSW 5 114216823 missense probably damaging 0.98
R6429:Acacb UTSW 5 114228591 missense probably damaging 1.00
R6942:Acacb UTSW 5 114191963 critical splice donor site probably null
R7138:Acacb UTSW 5 114207326 missense probably benign 0.12
R7241:Acacb UTSW 5 114245100 missense possibly damaging 0.94
R7254:Acacb UTSW 5 114209751 critical splice acceptor site probably null
R7396:Acacb UTSW 5 114213661 missense possibly damaging 0.87
R7439:Acacb UTSW 5 114195642 missense possibly damaging 0.84
R7484:Acacb UTSW 5 114218862 missense probably damaging 1.00
R7712:Acacb UTSW 5 114165738 missense probably benign 0.13
R7868:Acacb UTSW 5 114248227 missense probably benign 0.22
R7873:Acacb UTSW 5 114223278 missense possibly damaging 0.88
R7924:Acacb UTSW 5 114245220 missense possibly damaging 0.63
R7940:Acacb UTSW 5 114166047 missense possibly damaging 0.77
R7951:Acacb UTSW 5 114188340 missense probably damaging 1.00
R7960:Acacb UTSW 5 114230861 missense probably benign 0.00
R7972:Acacb UTSW 5 114226857 nonsense probably null
R8007:Acacb UTSW 5 114218874 missense probably damaging 0.97
R8022:Acacb UTSW 5 114223854 missense probably benign
R8030:Acacb UTSW 5 114233167 missense probably damaging 1.00
R8241:Acacb UTSW 5 114195236 missense possibly damaging 0.49
R8264:Acacb UTSW 5 114207366 missense probably benign 0.00
R8292:Acacb UTSW 5 114200494 critical splice acceptor site probably null
V1662:Acacb UTSW 5 114238708 missense probably damaging 1.00
Z1176:Acacb UTSW 5 114248948 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- AGGAGAATAGCCTGCCCAAG -3'
(R):5'- CGTACATGCCTGTAAAGATCATAGG -3'

Sequencing Primer
(F):5'- AAGGTCACATGGGCCCTGAG -3'
(R):5'- CCACCTTACATTTTGAGGCAGGG -3'
Posted On2019-10-24