Incidental Mutation 'R7585:Acacb'
ID 587041
Institutional Source Beutler Lab
Gene Symbol Acacb
Ensembl Gene ENSMUSG00000042010
Gene Name acetyl-Coenzyme A carboxylase beta
Synonyms Acc2, Accb
MMRRC Submission 045635-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7585 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 114284748-114388822 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 114384073 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 2201 (I2201V)
Ref Sequence ENSEMBL: ENSMUSP00000031583 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031583] [ENSMUST00000102582]
AlphaFold E9Q4Z2
Predicted Effect probably damaging
Transcript: ENSMUST00000031583
AA Change: I2201V

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000031583
Gene: ENSMUSG00000042010
AA Change: I2201V

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
low complexity region 38 60 N/A INTRINSIC
Pfam:CPSase_L_chain 249 369 2.1e-32 PFAM
Pfam:CPSase_L_D2 405 606 3.3e-52 PFAM
Pfam:ATP-grasp_4 413 576 2.1e-9 PFAM
Biotin_carb_C 640 747 9.54e-26 SMART
Pfam:Biotin_lipoyl 885 951 1.9e-17 PFAM
Pfam:ACC_central 952 1678 2.2e-290 PFAM
Pfam:Carboxyl_trans 1770 2324 2.3e-181 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000102582
AA Change: I2201V

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000099642
Gene: ENSMUSG00000042010
AA Change: I2201V

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
low complexity region 38 60 N/A INTRINSIC
Pfam:CPSase_L_chain 249 369 8.2e-29 PFAM
Pfam:CPSase_L_D2 405 606 3.8e-52 PFAM
Pfam:ATP-grasp_4 409 576 1.4e-12 PFAM
Biotin_carb_C 640 747 9.54e-26 SMART
Pfam:Biotin_lipoyl 885 951 9.1e-17 PFAM
Pfam:ACC_central 952 1678 2.3e-250 PFAM
Pfam:Carboxyl_trans 1770 2324 4.8e-172 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Acetyl-CoA carboxylase (ACC) is a complex multifunctional enzyme system. ACC is a biotin-containing enzyme which catalyzes the carboxylation of acetyl-CoA to malonyl-CoA, the rate-limiting step in fatty acid synthesis. ACC-beta is thought to control fatty acid oxidation by means of the ability of malonyl-CoA to inhibit carnitine-palmitoyl-CoA transferase I, the rate-limiting step in fatty acid uptake and oxidation by mitochondria. ACC-beta may be involved in the regulation of fatty acid oxidation, rather than fatty acid biosynthesis. There is evidence for the presence of two ACC-beta isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted null mutation are viable, fertile and overtly normal but exhibit high levels of fatty acid oxidation, as well as reduced fat accumulation in their adipose tissue and liver, and decreased storage of glycogen in their liver. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 105 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700034J05Rik T C 6: 146,854,851 (GRCm39) T64A probably benign Het
A930009A15Rik T A 10: 115,414,230 (GRCm39) V52D unknown Het
Aadacl2fm2 C A 3: 59,651,143 (GRCm39) D88E possibly damaging Het
Aco2 A C 15: 81,756,685 (GRCm39) probably benign Het
Acod1 C T 14: 103,292,177 (GRCm39) Q234* probably null Het
Actr6 T C 10: 89,561,658 (GRCm39) S163G probably benign Het
Agmat T C 4: 141,477,056 (GRCm39) V154A probably benign Het
Agrn T C 4: 156,255,131 (GRCm39) N1584S probably benign Het
Alg6 A T 4: 99,626,371 (GRCm39) S60C probably damaging Het
Ap5s1 T C 2: 131,054,482 (GRCm39) F98L probably damaging Het
Atp6v1f G A 6: 29,467,927 (GRCm39) V38I possibly damaging Het
B3gnt3 T C 8: 72,145,972 (GRCm39) T186A probably damaging Het
Brpf1 T C 6: 113,292,007 (GRCm39) V351A possibly damaging Het
Cacna1g A G 11: 94,364,368 (GRCm39) S26P probably benign Het
Camta1 G A 4: 151,229,287 (GRCm39) S515L probably damaging Het
Ccdc122 C A 14: 77,329,139 (GRCm39) A64E probably damaging Het
Ccdc89 C A 7: 90,076,510 (GRCm39) T240K possibly damaging Het
Cercam T C 2: 29,771,743 (GRCm39) L521P probably damaging Het
Cfb T C 17: 35,076,737 (GRCm39) N561S probably benign Het
Clk3 T C 9: 57,669,119 (GRCm39) E159G probably damaging Het
Cntf A T 19: 12,741,587 (GRCm39) L91* probably null Het
Cntn4 T A 6: 106,466,572 (GRCm39) I158N probably damaging Het
Cog5 T A 12: 31,810,888 (GRCm39) I194K probably damaging Het
Col22a1 T A 15: 71,764,054 (GRCm39) D66V probably damaging Het
Crat C T 2: 30,294,577 (GRCm39) R497Q probably benign Het
Csmd3 T C 15: 48,485,471 (GRCm39) T145A possibly damaging Het
D130043K22Rik A G 13: 25,069,568 (GRCm39) I876V probably benign Het
Dlec1 T C 9: 118,971,819 (GRCm39) S1335P probably benign Het
Dnah5 A T 15: 28,402,014 (GRCm39) T3392S probably benign Het
Dnal1 A G 12: 84,171,267 (GRCm39) K21E probably benign Het
Dspp T C 5: 104,323,391 (GRCm39) V178A possibly damaging Het
Dst A G 1: 34,153,096 (GRCm39) D119G possibly damaging Het
Dyrk4 T A 6: 126,867,007 (GRCm39) I342F probably damaging Het
Eif3b A G 5: 140,425,757 (GRCm39) D649G probably damaging Het
Exoc7 T C 11: 116,191,124 (GRCm39) D259G probably benign Het
Fancm T C 12: 65,153,021 (GRCm39) V1159A possibly damaging Het
Fat3 T C 9: 15,909,558 (GRCm39) D2148G probably benign Het
Fdps C A 3: 89,001,113 (GRCm39) R300L probably benign Het
Gfm2 T C 13: 97,315,540 (GRCm39) L736P probably benign Het
Grin2b T A 6: 135,756,301 (GRCm39) T475S probably damaging Het
H2-M3 T G 17: 37,581,599 (GRCm39) L87R probably damaging Het
Hao1 T A 2: 134,343,076 (GRCm39) I272F probably damaging Het
Hapln2 C T 3: 87,929,980 (GRCm39) G299S probably damaging Het
Hdac3 A T 18: 38,078,408 (GRCm39) I154N probably damaging Het
Herc1 A G 9: 66,352,829 (GRCm39) D2105G probably damaging Het
Kcna2 T C 3: 107,012,658 (GRCm39) F413S probably damaging Het
Kctd13 A G 7: 126,528,458 (GRCm39) T78A possibly damaging Het
Kif20a A G 18: 34,758,591 (GRCm39) D20G probably benign Het
Kif26b A T 1: 178,744,061 (GRCm39) I1386F probably benign Het
Klc4 T A 17: 46,942,810 (GRCm39) M585L probably benign Het
Lrp4 A G 2: 91,322,933 (GRCm39) Y1139C probably damaging Het
Lrp5 A T 19: 3,654,094 (GRCm39) I1111N possibly damaging Het
Lrriq1 A T 10: 103,050,807 (GRCm39) D648E possibly damaging Het
Mmp2 G A 8: 93,563,564 (GRCm39) G346D probably damaging Het
Mrgpra4 T A 7: 47,631,377 (GRCm39) I75L probably benign Het
Muc4 T A 16: 32,586,076 (GRCm39) V537D Het
Myh2 T A 11: 67,070,237 (GRCm39) probably null Het
Myrf T C 19: 10,194,091 (GRCm39) T487A probably damaging Het
Nalcn A T 14: 123,753,050 (GRCm39) L312H probably damaging Het
Nop14 G A 5: 34,802,124 (GRCm39) P560L probably damaging Het
Nufip1 C G 14: 76,348,427 (GRCm39) P19A probably benign Het
Oosp3 G T 19: 11,678,322 (GRCm39) M99I probably benign Het
Or14c40 T C 7: 86,313,880 (GRCm39) *337Q probably null Het
Or4c52 A T 2: 89,845,393 (GRCm39) I40F probably damaging Het
Or4x13 T A 2: 90,231,367 (GRCm39) Y121N probably damaging Het
Or51aa5 C A 7: 103,167,166 (GRCm39) V142L possibly damaging Het
Or51k2 A G 7: 103,596,607 (GRCm39) N278S probably benign Het
Or52n4b C A 7: 108,144,598 (GRCm39) P289T probably damaging Het
Or6b2b A G 1: 92,419,042 (GRCm39) V145A probably benign Het
Or7e175 T C 9: 20,040,307 (GRCm39) Het
Panx2 A G 15: 88,952,169 (GRCm39) K212R probably damaging Het
Paxip1 A C 5: 27,977,002 (GRCm39) H353Q unknown Het
Pbx4 C A 8: 70,285,475 (GRCm39) D39E probably damaging Het
Phc2 G A 4: 128,604,932 (GRCm39) A223T probably benign Het
Plcl1 A G 1: 55,445,608 (GRCm39) D21G probably benign Het
Plec G A 15: 76,057,632 (GRCm39) R4102W probably damaging Het
Plekhh2 A G 17: 84,884,608 (GRCm39) Y774C probably benign Het
Polr2a A T 11: 69,630,828 (GRCm39) Y1197N probably damaging Het
Psmg4 A T 13: 34,347,195 (GRCm39) H46L probably benign Het
Ptprk A G 10: 28,436,084 (GRCm39) Y815C probably damaging Het
Qrich2 T C 11: 116,346,547 (GRCm39) I1426V probably benign Het
Rbm43 T C 2: 51,816,763 (GRCm39) D68G probably benign Het
Rgs6 T C 12: 83,153,644 (GRCm39) S360P probably damaging Het
Rp1l1 T G 14: 64,267,588 (GRCm39) L1058R probably damaging Het
Rreb1 A G 13: 38,077,874 (GRCm39) S29G probably benign Het
Scube1 C A 15: 83,522,988 (GRCm39) R284L possibly damaging Het
Serpinb9h G T 13: 33,588,299 (GRCm39) D295Y probably benign Het
Slc13a3 T C 2: 165,272,242 (GRCm39) Q267R probably benign Het
Slc49a3 T C 5: 108,596,685 (GRCm39) T16A probably benign Het
Slc5a1 A T 5: 33,318,288 (GRCm39) N647I probably damaging Het
Sphk2 A T 7: 45,361,006 (GRCm39) S333T probably benign Het
Sptan1 A G 2: 29,890,068 (GRCm39) D1050G probably benign Het
Tdo2 G T 3: 81,870,065 (GRCm39) A269E probably damaging Het
Tnc A T 4: 63,938,648 (GRCm39) C64S probably damaging Het
Trim47 T A 11: 115,998,383 (GRCm39) E360D probably damaging Het
Trp53i13 T A 11: 77,399,129 (GRCm39) T374S possibly damaging Het
Try5 A G 6: 41,288,748 (GRCm39) L157P probably benign Het
Ttn A T 2: 76,578,176 (GRCm39) V24239D probably damaging Het
Ttn T C 2: 76,773,667 (GRCm39) Y2318C unknown Het
Txn1 T C 4: 57,945,199 (GRCm39) D68G possibly damaging Het
Upf3a A G 8: 13,837,418 (GRCm39) D121G probably damaging Het
Vmn2r114 T C 17: 23,510,239 (GRCm39) Y747C probably damaging Het
Vmn2r68 A G 7: 84,881,587 (GRCm39) W498R probably damaging Het
Vwa8 A C 14: 79,219,674 (GRCm39) probably null Het
Zp2 A T 7: 119,733,167 (GRCm39) F591L probably damaging Het
Other mutations in Acacb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00482:Acacb APN 5 114,338,350 (GRCm39) missense probably damaging 1.00
IGL01291:Acacb APN 5 114,363,931 (GRCm39) missense probably benign 0.03
IGL01301:Acacb APN 5 114,384,559 (GRCm39) missense probably benign
IGL01633:Acacb APN 5 114,356,919 (GRCm39) splice site probably benign
IGL01736:Acacb APN 5 114,326,503 (GRCm39) missense possibly damaging 0.96
IGL01782:Acacb APN 5 114,338,581 (GRCm39) missense probably damaging 1.00
IGL01924:Acacb APN 5 114,362,047 (GRCm39) splice site probably benign
IGL01933:Acacb APN 5 114,322,251 (GRCm39) splice site probably benign
IGL02028:Acacb APN 5 114,304,076 (GRCm39) missense probably damaging 1.00
IGL02045:Acacb APN 5 114,378,721 (GRCm39) missense possibly damaging 0.95
IGL02346:Acacb APN 5 114,376,760 (GRCm39) missense probably damaging 1.00
IGL02421:Acacb APN 5 114,361,939 (GRCm39) missense probably benign 0.00
IGL02445:Acacb APN 5 114,383,198 (GRCm39) missense probably damaging 1.00
IGL02491:Acacb APN 5 114,330,166 (GRCm39) missense probably damaging 1.00
IGL02598:Acacb APN 5 114,384,098 (GRCm39) missense probably damaging 1.00
IGL02700:Acacb APN 5 114,356,942 (GRCm39) missense probably damaging 1.00
IGL02730:Acacb APN 5 114,304,210 (GRCm39) splice site probably benign
IGL03110:Acacb APN 5 114,333,295 (GRCm39) missense probably damaging 0.96
IGL03125:Acacb APN 5 114,342,866 (GRCm39) missense possibly damaging 0.49
IGL03263:Acacb APN 5 114,351,754 (GRCm39) missense probably damaging 1.00
IGL03324:Acacb APN 5 114,363,915 (GRCm39) nonsense probably null
acetone UTSW 5 114,364,918 (GRCm39) nonsense probably null
anabolism UTSW 5 114,383,281 (GRCm39) missense possibly damaging 0.63
ANU05:Acacb UTSW 5 114,363,931 (GRCm39) missense probably benign 0.03
ANU18:Acacb UTSW 5 114,384,559 (GRCm39) missense probably benign
BB001:Acacb UTSW 5 114,383,281 (GRCm39) missense possibly damaging 0.63
BB011:Acacb UTSW 5 114,383,281 (GRCm39) missense possibly damaging 0.63
I0000:Acacb UTSW 5 114,376,716 (GRCm39) missense probably damaging 0.99
R0001:Acacb UTSW 5 114,342,894 (GRCm39) splice site probably benign
R0219:Acacb UTSW 5 114,371,005 (GRCm39) missense possibly damaging 0.79
R0234:Acacb UTSW 5 114,347,878 (GRCm39) missense probably damaging 0.99
R0234:Acacb UTSW 5 114,347,878 (GRCm39) missense probably damaging 0.99
R0278:Acacb UTSW 5 114,371,320 (GRCm39) nonsense probably null
R0607:Acacb UTSW 5 114,338,362 (GRCm39) missense probably damaging 1.00
R0964:Acacb UTSW 5 114,367,813 (GRCm39) missense possibly damaging 0.64
R1116:Acacb UTSW 5 114,349,017 (GRCm39) missense probably damaging 1.00
R1196:Acacb UTSW 5 114,383,153 (GRCm39) missense probably benign 0.00
R1204:Acacb UTSW 5 114,328,214 (GRCm39) missense probably damaging 1.00
R1387:Acacb UTSW 5 114,338,573 (GRCm39) missense probably benign
R1415:Acacb UTSW 5 114,303,982 (GRCm39) missense probably benign
R1475:Acacb UTSW 5 114,333,313 (GRCm39) missense possibly damaging 0.87
R1497:Acacb UTSW 5 114,334,868 (GRCm39) missense probably damaging 1.00
R1520:Acacb UTSW 5 114,340,001 (GRCm39) missense possibly damaging 0.67
R1591:Acacb UTSW 5 114,341,484 (GRCm39) missense possibly damaging 0.87
R1644:Acacb UTSW 5 114,333,346 (GRCm39) missense probably damaging 1.00
R1732:Acacb UTSW 5 114,328,148 (GRCm39) missense possibly damaging 0.63
R1783:Acacb UTSW 5 114,347,828 (GRCm39) frame shift probably null
R1784:Acacb UTSW 5 114,347,828 (GRCm39) frame shift probably null
R1834:Acacb UTSW 5 114,373,536 (GRCm39) missense probably damaging 1.00
R1858:Acacb UTSW 5 114,334,770 (GRCm39) missense probably benign 0.13
R1886:Acacb UTSW 5 114,357,020 (GRCm39) missense probably damaging 1.00
R1901:Acacb UTSW 5 114,303,795 (GRCm39) nonsense probably null
R1902:Acacb UTSW 5 114,303,795 (GRCm39) nonsense probably null
R1903:Acacb UTSW 5 114,303,795 (GRCm39) nonsense probably null
R1924:Acacb UTSW 5 114,368,781 (GRCm39) missense possibly damaging 0.67
R1934:Acacb UTSW 5 114,336,343 (GRCm39) missense probably benign 0.27
R2051:Acacb UTSW 5 114,383,951 (GRCm39) missense probably damaging 1.00
R2132:Acacb UTSW 5 114,347,828 (GRCm39) frame shift probably null
R2133:Acacb UTSW 5 114,347,828 (GRCm39) frame shift probably null
R2260:Acacb UTSW 5 114,354,978 (GRCm39) missense probably damaging 0.99
R2967:Acacb UTSW 5 114,304,131 (GRCm39) missense possibly damaging 0.81
R3421:Acacb UTSW 5 114,350,697 (GRCm39) splice site probably null
R3729:Acacb UTSW 5 114,345,409 (GRCm39) missense probably damaging 0.99
R4206:Acacb UTSW 5 114,351,712 (GRCm39) missense probably benign
R4245:Acacb UTSW 5 114,368,845 (GRCm39) missense probably damaging 0.97
R4386:Acacb UTSW 5 114,379,982 (GRCm39) critical splice acceptor site probably null
R4439:Acacb UTSW 5 114,384,557 (GRCm39) missense possibly damaging 0.50
R4577:Acacb UTSW 5 114,364,892 (GRCm39) missense probably damaging 1.00
R4658:Acacb UTSW 5 114,338,625 (GRCm39) missense probably damaging 0.96
R4688:Acacb UTSW 5 114,342,824 (GRCm39) missense probably benign 0.01
R4720:Acacb UTSW 5 114,367,975 (GRCm39) missense possibly damaging 0.73
R4898:Acacb UTSW 5 114,370,999 (GRCm39) missense probably benign 0.04
R5044:Acacb UTSW 5 114,304,088 (GRCm39) missense probably benign 0.03
R5070:Acacb UTSW 5 114,384,089 (GRCm39) missense possibly damaging 0.46
R5294:Acacb UTSW 5 114,380,013 (GRCm39) missense probably damaging 1.00
R5350:Acacb UTSW 5 114,382,612 (GRCm39) missense probably damaging 1.00
R5401:Acacb UTSW 5 114,347,914 (GRCm39) missense possibly damaging 0.80
R5531:Acacb UTSW 5 114,342,767 (GRCm39) missense possibly damaging 0.92
R5542:Acacb UTSW 5 114,333,798 (GRCm39) missense probably damaging 1.00
R5751:Acacb UTSW 5 114,368,893 (GRCm39) missense possibly damaging 0.79
R5821:Acacb UTSW 5 114,322,167 (GRCm39) missense possibly damaging 0.69
R5893:Acacb UTSW 5 114,367,912 (GRCm39) missense probably benign 0.01
R5911:Acacb UTSW 5 114,370,951 (GRCm39) missense probably damaging 0.97
R5944:Acacb UTSW 5 114,384,041 (GRCm39) missense probably damaging 1.00
R5973:Acacb UTSW 5 114,364,928 (GRCm39) missense probably damaging 1.00
R6027:Acacb UTSW 5 114,303,661 (GRCm39) missense probably benign 0.43
R6103:Acacb UTSW 5 114,383,942 (GRCm39) missense probably damaging 1.00
R6139:Acacb UTSW 5 114,350,713 (GRCm39) missense probably damaging 1.00
R6292:Acacb UTSW 5 114,338,312 (GRCm39) missense probably damaging 1.00
R6368:Acacb UTSW 5 114,354,884 (GRCm39) missense probably damaging 0.98
R6429:Acacb UTSW 5 114,366,652 (GRCm39) missense probably damaging 1.00
R6942:Acacb UTSW 5 114,330,024 (GRCm39) critical splice donor site probably null
R7138:Acacb UTSW 5 114,345,387 (GRCm39) missense probably benign 0.12
R7241:Acacb UTSW 5 114,383,161 (GRCm39) missense possibly damaging 0.94
R7254:Acacb UTSW 5 114,347,812 (GRCm39) critical splice acceptor site probably null
R7396:Acacb UTSW 5 114,351,722 (GRCm39) missense possibly damaging 0.87
R7439:Acacb UTSW 5 114,333,703 (GRCm39) missense possibly damaging 0.84
R7484:Acacb UTSW 5 114,356,923 (GRCm39) missense probably damaging 1.00
R7712:Acacb UTSW 5 114,303,799 (GRCm39) missense probably benign 0.13
R7868:Acacb UTSW 5 114,386,288 (GRCm39) missense probably benign 0.22
R7873:Acacb UTSW 5 114,361,339 (GRCm39) missense possibly damaging 0.88
R7924:Acacb UTSW 5 114,383,281 (GRCm39) missense possibly damaging 0.63
R7940:Acacb UTSW 5 114,304,108 (GRCm39) missense possibly damaging 0.77
R7951:Acacb UTSW 5 114,326,401 (GRCm39) missense probably damaging 1.00
R7960:Acacb UTSW 5 114,368,922 (GRCm39) missense probably benign 0.00
R7972:Acacb UTSW 5 114,364,918 (GRCm39) nonsense probably null
R8007:Acacb UTSW 5 114,356,935 (GRCm39) missense probably damaging 0.97
R8022:Acacb UTSW 5 114,361,915 (GRCm39) missense probably benign
R8030:Acacb UTSW 5 114,371,228 (GRCm39) missense probably damaging 1.00
R8241:Acacb UTSW 5 114,333,297 (GRCm39) missense possibly damaging 0.49
R8264:Acacb UTSW 5 114,345,427 (GRCm39) missense probably benign 0.00
R8292:Acacb UTSW 5 114,338,555 (GRCm39) critical splice acceptor site probably null
R8678:Acacb UTSW 5 114,340,032 (GRCm39) nonsense probably null
R8693:Acacb UTSW 5 114,364,844 (GRCm39) missense probably damaging 0.99
R8697:Acacb UTSW 5 114,351,441 (GRCm39) missense probably damaging 0.96
R8772:Acacb UTSW 5 114,322,179 (GRCm39) missense possibly damaging 0.73
R8918:Acacb UTSW 5 114,333,315 (GRCm39) missense probably damaging 1.00
R9008:Acacb UTSW 5 114,386,815 (GRCm39) splice site silent
R9044:Acacb UTSW 5 114,373,578 (GRCm39) missense probably benign 0.00
R9165:Acacb UTSW 5 114,354,744 (GRCm39) missense probably benign 0.01
R9231:Acacb UTSW 5 114,349,153 (GRCm39) missense probably benign 0.01
R9440:Acacb UTSW 5 114,384,085 (GRCm39) missense possibly damaging 0.56
R9444:Acacb UTSW 5 114,384,020 (GRCm39) missense probably damaging 0.99
R9562:Acacb UTSW 5 114,371,397 (GRCm39) missense probably damaging 0.99
R9794:Acacb UTSW 5 114,387,578 (GRCm39) missense probably benign 0.00
V1662:Acacb UTSW 5 114,376,769 (GRCm39) missense probably damaging 1.00
Z1176:Acacb UTSW 5 114,387,009 (GRCm39) missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- AGGAGAATAGCCTGCCCAAG -3'
(R):5'- CGTACATGCCTGTAAAGATCATAGG -3'

Sequencing Primer
(F):5'- AAGGTCACATGGGCCCTGAG -3'
(R):5'- CCACCTTACATTTTGAGGCAGGG -3'
Posted On 2019-10-24