Incidental Mutation 'R7585:Ptprk'
ID587069
Institutional Source Beutler Lab
Gene Symbol Ptprk
Ensembl Gene ENSMUSG00000019889
Gene Nameprotein tyrosine phosphatase, receptor type, K
SynonymsRPTPkappa, PTPk
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7585 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location28074820-28597397 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 28560088 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 815 (Y815C)
Ref Sequence ENSEMBL: ENSMUSP00000151866 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166468] [ENSMUST00000218276] [ENSMUST00000218359]
Predicted Effect probably damaging
Transcript: ENSMUST00000166468
AA Change: Y805C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000126279
Gene: ENSMUSG00000019889
AA Change: Y805C

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
MAM 30 193 1.61e-73 SMART
IG 200 288 2.16e-8 SMART
FN3 290 373 1.48e-4 SMART
FN3 389 475 4.24e1 SMART
FN3 491 579 3.32e-7 SMART
transmembrane domain 753 774 N/A INTRINSIC
PTPc 898 1161 3.56e-132 SMART
PTPc 1190 1455 2.68e-86 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000218276
AA Change: Y815C

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Predicted Effect probably damaging
Transcript: ENSMUST00000218359
AA Change: Y805C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably benign
Transcript: ENSMUST00000219621
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP possesses an extracellular region, a single transmembrane region, and two tandem catalytic domains, and thus represents a receptor-type PTP. The extracellular region contains a meprin-A5 antigen-PTP mu (MAM) domain, an Ig-like domain and four fibronectin type III-like repeats. This PTP was shown to mediate homophilic intercellular interaction, possibly through the interaction with beta- and gamma-catenin at adherens junctions. Expression of this gene was found to be stimulated by TGF-beta 1, which may be important for the inhibition of keratinocyte proliferation. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 105 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700034J05Rik T C 6: 146,953,353 T64A probably benign Het
A930009A15Rik T A 10: 115,578,325 V52D unknown Het
Acacb A G 5: 114,246,012 I2201V probably damaging Het
Aco2 A C 15: 81,872,484 probably benign Het
Acod1 C T 14: 103,054,741 Q234* probably null Het
Actr6 T C 10: 89,725,796 S163G probably benign Het
Agmat T C 4: 141,749,745 V154A probably benign Het
Agrn T C 4: 156,170,674 N1584S probably benign Het
Alg6 A T 4: 99,738,134 S60C probably damaging Het
Ap5s1 T C 2: 131,212,562 F98L probably damaging Het
Atp6v1f G A 6: 29,467,928 V38I possibly damaging Het
B3gnt3 T C 8: 71,693,328 T186A probably damaging Het
Brpf1 T C 6: 113,315,046 V351A possibly damaging Het
Cacna1g A G 11: 94,473,542 S26P probably benign Het
Camta1 G A 4: 151,144,830 S515L probably damaging Het
Ccdc122 C A 14: 77,091,699 A64E probably damaging Het
Ccdc89 C A 7: 90,427,302 T240K possibly damaging Het
Cercam T C 2: 29,881,731 L521P probably damaging Het
Cfb T C 17: 34,857,761 N561S probably benign Het
Clk3 T C 9: 57,761,836 E159G probably damaging Het
Cntf A T 19: 12,764,223 L91* probably null Het
Cntn4 T A 6: 106,489,611 I158N probably damaging Het
Cog5 T A 12: 31,760,889 I194K probably damaging Het
Col22a1 T A 15: 71,892,205 D66V probably damaging Het
Crat C T 2: 30,404,565 R497Q probably benign Het
Csmd3 T C 15: 48,622,075 T145A possibly damaging Het
D130043K22Rik A G 13: 24,885,585 I876V probably benign Het
Dlec1 T C 9: 119,142,751 S1335P probably benign Het
Dnah5 A T 15: 28,401,868 T3392S probably benign Het
Dnal1 A G 12: 84,124,493 K21E probably benign Het
Dspp T C 5: 104,175,525 V178A possibly damaging Het
Dst A G 1: 34,114,015 D119G possibly damaging Het
Dyrk4 T A 6: 126,890,044 I342F probably damaging Het
Eif3b A G 5: 140,440,002 D649G probably damaging Het
Exoc7 T C 11: 116,300,298 D259G probably benign Het
Fancm T C 12: 65,106,247 V1159A possibly damaging Het
Fat3 T C 9: 15,998,262 D2148G probably benign Het
Fdps C A 3: 89,093,806 R300L probably benign Het
Gfm2 T C 13: 97,179,032 L736P probably benign Het
Gm11397 G T 13: 33,404,316 D295Y probably benign Het
Gm5538 C A 3: 59,743,722 D88E possibly damaging Het
Grin2b T A 6: 135,779,303 T475S probably damaging Het
H2-M3 T G 17: 37,270,708 L87R probably damaging Het
Hao1 T A 2: 134,501,156 I272F probably damaging Het
Hapln2 C T 3: 88,022,673 G299S probably damaging Het
Hdac3 A T 18: 37,945,355 I154N probably damaging Het
Herc1 A G 9: 66,445,547 D2105G probably damaging Het
Kcna2 T C 3: 107,105,342 F413S probably damaging Het
Kctd13 A G 7: 126,929,286 T78A possibly damaging Het
Kif20a A G 18: 34,625,538 D20G probably benign Het
Kif26b A T 1: 178,916,496 I1386F probably benign Het
Klc4 T A 17: 46,631,884 M585L probably benign Het
Lrp4 A G 2: 91,492,588 Y1139C probably damaging Het
Lrp5 A T 19: 3,604,094 I1111N possibly damaging Het
Lrriq1 A T 10: 103,214,946 D648E possibly damaging Het
Mfsd7a T C 5: 108,448,819 T16A probably benign Het
Mmp2 G A 8: 92,836,936 G346D probably damaging Het
Mrgpra4 T A 7: 47,981,629 I75L probably benign Het
Muc4 T A 16: 32,765,702 V537D Het
Myh2 T A 11: 67,179,411 probably null Het
Myrf T C 19: 10,216,727 T487A probably damaging Het
Nalcn A T 14: 123,515,638 L312H probably damaging Het
Nop14 G A 5: 34,644,780 P560L probably damaging Het
Nufip1 C G 14: 76,110,987 P19A probably benign Het
Olfr1263 A T 2: 90,015,049 I40F probably damaging Het
Olfr1274-ps T A 2: 90,401,023 Y121N probably damaging Het
Olfr1415 A G 1: 92,491,320 V145A probably benign Het
Olfr293 T C 7: 86,664,672 *337Q probably null Het
Olfr503 C A 7: 108,545,391 P289T probably damaging Het
Olfr611 C A 7: 103,517,959 V142L possibly damaging Het
Olfr633 A G 7: 103,947,400 N278S probably benign Het
Olfr869 T C 9: 20,129,011 Het
Oosp3 G T 19: 11,700,958 M99I probably benign Het
Panx2 A G 15: 89,067,966 K212R probably damaging Het
Paxip1 A C 5: 27,772,004 H353Q unknown Het
Pbx4 C A 8: 69,832,825 D39E probably damaging Het
Phc2 G A 4: 128,711,139 A223T probably benign Het
Plcl1 A G 1: 55,406,449 D21G probably benign Het
Plec G A 15: 76,173,432 R4102W probably damaging Het
Plekhh2 A G 17: 84,577,180 Y774C probably benign Het
Polr2a A T 11: 69,740,002 Y1197N probably damaging Het
Psmg4 A T 13: 34,163,212 H46L probably benign Het
Qrich2 T C 11: 116,455,721 I1426V probably benign Het
Rbm43 T C 2: 51,926,751 D68G probably benign Het
Rgs6 T C 12: 83,106,870 S360P probably damaging Het
Rp1l1 T G 14: 64,030,139 L1058R probably damaging Het
Rreb1 A G 13: 37,893,898 S29G probably benign Het
Scube1 C A 15: 83,638,787 R284L possibly damaging Het
Slc13a3 T C 2: 165,430,322 Q267R probably benign Het
Slc5a1 A T 5: 33,160,944 N647I probably damaging Het
Sphk2 A T 7: 45,711,582 S333T probably benign Het
Sptan1 A G 2: 30,000,056 D1050G probably benign Het
Tdo2 G T 3: 81,962,758 A269E probably damaging Het
Tnc A T 4: 64,020,411 C64S probably damaging Het
Trim47 T A 11: 116,107,557 E360D probably damaging Het
Trp53i13 T A 11: 77,508,303 T374S possibly damaging Het
Try5 A G 6: 41,311,814 L157P probably benign Het
Ttn T C 2: 76,943,323 Y2318C unknown Het
Ttn A T 2: 76,747,832 V24239D probably damaging Het
Txn1 T C 4: 57,945,199 D68G possibly damaging Het
Upf3a A G 8: 13,787,418 D121G probably damaging Het
Vmn2r114 T C 17: 23,291,265 Y747C probably damaging Het
Vmn2r68 A G 7: 85,232,379 W498R probably damaging Het
Vwa8 A C 14: 78,982,234 probably null Het
Zp2 A T 7: 120,133,944 F591L probably damaging Het
Other mutations in Ptprk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00310:Ptprk APN 10 28336510 missense possibly damaging 0.92
IGL00533:Ptprk APN 10 28585975 missense probably damaging 0.97
IGL01062:Ptprk APN 10 28580418 missense probably damaging 1.00
IGL01295:Ptprk APN 10 28475178 missense probably benign 0.14
IGL01372:Ptprk APN 10 28569927 missense probably benign 0.00
IGL01452:Ptprk APN 10 28574917 critical splice donor site probably null
IGL01829:Ptprk APN 10 28573387 missense probably damaging 1.00
IGL01861:Ptprk APN 10 28383445 missense possibly damaging 0.80
IGL01955:Ptprk APN 10 28595865 unclassified probably benign
IGL02263:Ptprk APN 10 28075114 missense unknown
IGL02489:Ptprk APN 10 28383472 missense probably damaging 1.00
IGL02697:Ptprk APN 10 28575618 missense possibly damaging 0.85
IGL02713:Ptprk APN 10 28592811 missense possibly damaging 0.92
IGL02943:Ptprk APN 10 28475176 missense possibly damaging 0.81
IGL03240:Ptprk APN 10 28492961 missense probably damaging 0.99
IGL03373:Ptprk APN 10 28566537 missense probably damaging 1.00
LCD18:Ptprk UTSW 10 28574987 intron probably benign
PIT4366001:Ptprk UTSW 10 28586019 missense probably benign
R0010:Ptprk UTSW 10 28585969 missense probably damaging 1.00
R0021:Ptprk UTSW 10 28592895 missense probably damaging 1.00
R0021:Ptprk UTSW 10 28592895 missense probably damaging 1.00
R0035:Ptprk UTSW 10 28263508 nonsense probably null
R0035:Ptprk UTSW 10 28263508 nonsense probably null
R0053:Ptprk UTSW 10 28475109 missense probably damaging 0.99
R0063:Ptprk UTSW 10 28263767 missense probably damaging 1.00
R0063:Ptprk UTSW 10 28263767 missense probably damaging 1.00
R0244:Ptprk UTSW 10 28206225 missense possibly damaging 0.79
R0281:Ptprk UTSW 10 28573392 missense probably damaging 1.00
R0387:Ptprk UTSW 10 28354629 missense possibly damaging 0.66
R0480:Ptprk UTSW 10 28585947 missense probably damaging 1.00
R0480:Ptprk UTSW 10 28585948 missense probably damaging 1.00
R0585:Ptprk UTSW 10 28575668 missense probably damaging 1.00
R0614:Ptprk UTSW 10 28075136 missense probably damaging 0.96
R0684:Ptprk UTSW 10 28483298 splice site probably benign
R1073:Ptprk UTSW 10 28496947 critical splice donor site probably null
R1377:Ptprk UTSW 10 28586026 missense probably benign 0.42
R1422:Ptprk UTSW 10 28475280 missense possibly damaging 0.64
R1482:Ptprk UTSW 10 28263516 missense probably benign 0.24
R1532:Ptprk UTSW 10 28585630 missense probably damaging 1.00
R1576:Ptprk UTSW 10 28551651 missense probably damaging 1.00
R1618:Ptprk UTSW 10 28493170 missense probably benign 0.00
R1654:Ptprk UTSW 10 28383647 missense probably damaging 1.00
R1701:Ptprk UTSW 10 28466058 missense probably damaging 1.00
R1747:Ptprk UTSW 10 28354692 missense possibly damaging 0.78
R2033:Ptprk UTSW 10 28592767 unclassified probably benign
R2059:Ptprk UTSW 10 28566603 missense probably damaging 1.00
R2076:Ptprk UTSW 10 28589368 missense probably damaging 0.98
R2164:Ptprk UTSW 10 28560142 missense probably damaging 1.00
R2260:Ptprk UTSW 10 28206149 missense possibly damaging 0.65
R2394:Ptprk UTSW 10 28551717 missense probably damaging 0.98
R2432:Ptprk UTSW 10 28592844 missense probably damaging 1.00
R2437:Ptprk UTSW 10 28354713 missense probably damaging 1.00
R2495:Ptprk UTSW 10 28475078 splice site probably benign
R3037:Ptprk UTSW 10 28580478 missense probably damaging 1.00
R3162:Ptprk UTSW 10 28592826 missense probably benign
R3162:Ptprk UTSW 10 28592826 missense probably benign
R3687:Ptprk UTSW 10 28473043 missense probably damaging 1.00
R3722:Ptprk UTSW 10 28383623 missense probably damaging 1.00
R3892:Ptprk UTSW 10 28263621 missense probably benign 0.02
R3963:Ptprk UTSW 10 28551665 missense probably damaging 0.99
R4077:Ptprk UTSW 10 28263512 missense probably benign
R4079:Ptprk UTSW 10 28263512 missense probably benign
R4112:Ptprk UTSW 10 28475288 critical splice donor site probably null
R4255:Ptprk UTSW 10 28206245 missense probably benign 0.14
R4523:Ptprk UTSW 10 28466052 missense probably damaging 0.99
R4651:Ptprk UTSW 10 28263690 missense probably damaging 0.99
R4652:Ptprk UTSW 10 28263690 missense probably damaging 0.99
R4828:Ptprk UTSW 10 28560054 missense probably damaging 1.00
R4829:Ptprk UTSW 10 28580484 nonsense probably null
R4883:Ptprk UTSW 10 28588932 missense probably damaging 1.00
R5004:Ptprk UTSW 10 28586063 missense possibly damaging 0.95
R5013:Ptprk UTSW 10 28551717 missense probably damaging 0.99
R5092:Ptprk UTSW 10 28592773 missense probably damaging 1.00
R5126:Ptprk UTSW 10 28575644 splice site probably null
R5183:Ptprk UTSW 10 28475236 missense probably benign 0.02
R5264:Ptprk UTSW 10 28585586 missense probably damaging 1.00
R5304:Ptprk UTSW 10 28592054 splice site probably null
R5330:Ptprk UTSW 10 28587080 missense probably damaging 1.00
R5474:Ptprk UTSW 10 28496930 nonsense probably null
R5516:Ptprk UTSW 10 28496930 nonsense probably null
R5796:Ptprk UTSW 10 28383575 missense probably damaging 1.00
R5843:Ptprk UTSW 10 28493064 missense probably damaging 0.99
R5952:Ptprk UTSW 10 28585675 missense probably damaging 0.99
R6065:Ptprk UTSW 10 28475170 missense probably damaging 1.00
R6226:Ptprk UTSW 10 28564103 missense probably benign 0.02
R6264:Ptprk UTSW 10 28566673 missense probably damaging 1.00
R6638:Ptprk UTSW 10 28595811 missense probably damaging 1.00
R6843:Ptprk UTSW 10 28591982 missense possibly damaging 0.86
R6860:Ptprk UTSW 10 28334484 missense probably damaging 1.00
R6869:Ptprk UTSW 10 28473059 critical splice donor site probably null
R7214:Ptprk UTSW 10 28574909 missense probably benign 0.11
R7307:Ptprk UTSW 10 28589008 nonsense probably null
R7349:Ptprk UTSW 10 28592838 missense possibly damaging 0.85
R7442:Ptprk UTSW 10 28574819 missense probably damaging 1.00
R7661:Ptprk UTSW 10 28466040 missense probably benign 0.00
R7694:Ptprk UTSW 10 28589370 missense possibly damaging 0.63
R7740:Ptprk UTSW 10 28496924 missense probably damaging 1.00
R7810:Ptprk UTSW 10 28592857 missense probably damaging 0.97
R7831:Ptprk UTSW 10 28568408 missense possibly damaging 0.89
R7836:Ptprk UTSW 10 28573389 missense probably damaging 1.00
R8049:Ptprk UTSW 10 28383569 missense possibly damaging 0.84
R8235:Ptprk UTSW 10 28589041 missense possibly damaging 0.70
R8274:Ptprk UTSW 10 28580412 missense probably damaging 1.00
R8286:Ptprk UTSW 10 28568327 missense probably damaging 1.00
R8372:Ptprk UTSW 10 28354692 missense possibly damaging 0.78
Z1177:Ptprk UTSW 10 28493120 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCGTGTTATCGTAACTCCTG -3'
(R):5'- ATAACGTCAGTTGTGTTTTACTCTC -3'

Sequencing Primer
(F):5'- CGTAACTCCTGAAATTAGGAACAG -3'
(R):5'- AGTTGTGTTTTACTCTCCCTAACTG -3'
Posted On2019-10-24