Incidental Mutation 'R7585:Lrriq1'
ID587071
Institutional Source Beutler Lab
Gene Symbol Lrriq1
Ensembl Gene ENSMUSG00000019892
Gene Nameleucine-rich repeats and IQ motif containing 1
SynonymsLOC380658, 4930503E15Rik, Gm1557
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.081) question?
Stock #R7585 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location103046031-103236322 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 103214946 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 648 (D648E)
Ref Sequence ENSEMBL: ENSMUSP00000020043 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020043] [ENSMUST00000123364] [ENSMUST00000166240]
Predicted Effect possibly damaging
Transcript: ENSMUST00000020043
AA Change: D648E

PolyPhen 2 Score 0.934 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000020043
Gene: ENSMUSG00000019892
AA Change: D648E

DomainStartEndE-ValueType
coiled coil region 11 31 N/A INTRINSIC
low complexity region 35 48 N/A INTRINSIC
coiled coil region 183 286 N/A INTRINSIC
Blast:IQ 290 312 1e-6 BLAST
coiled coil region 314 390 N/A INTRINSIC
low complexity region 550 559 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123364
SMART Domains Protein: ENSMUSP00000119783
Gene: ENSMUSG00000019892

DomainStartEndE-ValueType
coiled coil region 11 31 N/A INTRINSIC
low complexity region 35 48 N/A INTRINSIC
coiled coil region 183 286 N/A INTRINSIC
Blast:IQ 290 312 6e-6 BLAST
coiled coil region 314 390 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000166240
AA Change: D648E

PolyPhen 2 Score 0.900 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000131419
Gene: ENSMUSG00000019892
AA Change: D648E

DomainStartEndE-ValueType
coiled coil region 11 31 N/A INTRINSIC
low complexity region 35 48 N/A INTRINSIC
coiled coil region 183 286 N/A INTRINSIC
IQ 290 312 9.78e1 SMART
coiled coil region 314 390 N/A INTRINSIC
low complexity region 550 559 N/A INTRINSIC
LRR 873 894 2.14e1 SMART
LRR 895 917 4.45e1 SMART
LRR 984 1005 2.03e2 SMART
LRR 1029 1052 3.65e0 SMART
low complexity region 1244 1258 N/A INTRINSIC
IQ 1279 1301 5.61e1 SMART
IQ 1339 1361 6.7e-3 SMART
low complexity region 1369 1394 N/A INTRINSIC
low complexity region 1502 1518 N/A INTRINSIC
low complexity region 1528 1543 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 105 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700034J05Rik T C 6: 146,953,353 T64A probably benign Het
A930009A15Rik T A 10: 115,578,325 V52D unknown Het
Acacb A G 5: 114,246,012 I2201V probably damaging Het
Aco2 A C 15: 81,872,484 probably benign Het
Acod1 C T 14: 103,054,741 Q234* probably null Het
Actr6 T C 10: 89,725,796 S163G probably benign Het
Agmat T C 4: 141,749,745 V154A probably benign Het
Agrn T C 4: 156,170,674 N1584S probably benign Het
Alg6 A T 4: 99,738,134 S60C probably damaging Het
Ap5s1 T C 2: 131,212,562 F98L probably damaging Het
Atp6v1f G A 6: 29,467,928 V38I possibly damaging Het
B3gnt3 T C 8: 71,693,328 T186A probably damaging Het
Brpf1 T C 6: 113,315,046 V351A possibly damaging Het
Cacna1g A G 11: 94,473,542 S26P probably benign Het
Camta1 G A 4: 151,144,830 S515L probably damaging Het
Ccdc122 C A 14: 77,091,699 A64E probably damaging Het
Ccdc89 C A 7: 90,427,302 T240K possibly damaging Het
Cercam T C 2: 29,881,731 L521P probably damaging Het
Cfb T C 17: 34,857,761 N561S probably benign Het
Clk3 T C 9: 57,761,836 E159G probably damaging Het
Cntf A T 19: 12,764,223 L91* probably null Het
Cntn4 T A 6: 106,489,611 I158N probably damaging Het
Cog5 T A 12: 31,760,889 I194K probably damaging Het
Col22a1 T A 15: 71,892,205 D66V probably damaging Het
Crat C T 2: 30,404,565 R497Q probably benign Het
Csmd3 T C 15: 48,622,075 T145A possibly damaging Het
D130043K22Rik A G 13: 24,885,585 I876V probably benign Het
Dlec1 T C 9: 119,142,751 S1335P probably benign Het
Dnah5 A T 15: 28,401,868 T3392S probably benign Het
Dnal1 A G 12: 84,124,493 K21E probably benign Het
Dspp T C 5: 104,175,525 V178A possibly damaging Het
Dst A G 1: 34,114,015 D119G possibly damaging Het
Dyrk4 T A 6: 126,890,044 I342F probably damaging Het
Eif3b A G 5: 140,440,002 D649G probably damaging Het
Exoc7 T C 11: 116,300,298 D259G probably benign Het
Fancm T C 12: 65,106,247 V1159A possibly damaging Het
Fat3 T C 9: 15,998,262 D2148G probably benign Het
Fdps C A 3: 89,093,806 R300L probably benign Het
Gfm2 T C 13: 97,179,032 L736P probably benign Het
Gm11397 G T 13: 33,404,316 D295Y probably benign Het
Gm5538 C A 3: 59,743,722 D88E possibly damaging Het
Grin2b T A 6: 135,779,303 T475S probably damaging Het
H2-M3 T G 17: 37,270,708 L87R probably damaging Het
Hao1 T A 2: 134,501,156 I272F probably damaging Het
Hapln2 C T 3: 88,022,673 G299S probably damaging Het
Hdac3 A T 18: 37,945,355 I154N probably damaging Het
Herc1 A G 9: 66,445,547 D2105G probably damaging Het
Kcna2 T C 3: 107,105,342 F413S probably damaging Het
Kctd13 A G 7: 126,929,286 T78A possibly damaging Het
Kif20a A G 18: 34,625,538 D20G probably benign Het
Kif26b A T 1: 178,916,496 I1386F probably benign Het
Klc4 T A 17: 46,631,884 M585L probably benign Het
Lrp4 A G 2: 91,492,588 Y1139C probably damaging Het
Lrp5 A T 19: 3,604,094 I1111N possibly damaging Het
Mfsd7a T C 5: 108,448,819 T16A probably benign Het
Mmp2 G A 8: 92,836,936 G346D probably damaging Het
Mrgpra4 T A 7: 47,981,629 I75L probably benign Het
Muc4 T A 16: 32,765,702 V537D Het
Myh2 T A 11: 67,179,411 probably null Het
Myrf T C 19: 10,216,727 T487A probably damaging Het
Nalcn A T 14: 123,515,638 L312H probably damaging Het
Nop14 G A 5: 34,644,780 P560L probably damaging Het
Nufip1 C G 14: 76,110,987 P19A probably benign Het
Olfr1263 A T 2: 90,015,049 I40F probably damaging Het
Olfr1274-ps T A 2: 90,401,023 Y121N probably damaging Het
Olfr1415 A G 1: 92,491,320 V145A probably benign Het
Olfr293 T C 7: 86,664,672 *337Q probably null Het
Olfr503 C A 7: 108,545,391 P289T probably damaging Het
Olfr611 C A 7: 103,517,959 V142L possibly damaging Het
Olfr633 A G 7: 103,947,400 N278S probably benign Het
Olfr869 T C 9: 20,129,011 Het
Oosp3 G T 19: 11,700,958 M99I probably benign Het
Panx2 A G 15: 89,067,966 K212R probably damaging Het
Paxip1 A C 5: 27,772,004 H353Q unknown Het
Pbx4 C A 8: 69,832,825 D39E probably damaging Het
Phc2 G A 4: 128,711,139 A223T probably benign Het
Plcl1 A G 1: 55,406,449 D21G probably benign Het
Plec G A 15: 76,173,432 R4102W probably damaging Het
Plekhh2 A G 17: 84,577,180 Y774C probably benign Het
Polr2a A T 11: 69,740,002 Y1197N probably damaging Het
Psmg4 A T 13: 34,163,212 H46L probably benign Het
Ptprk A G 10: 28,560,088 Y815C probably damaging Het
Qrich2 T C 11: 116,455,721 I1426V probably benign Het
Rbm43 T C 2: 51,926,751 D68G probably benign Het
Rgs6 T C 12: 83,106,870 S360P probably damaging Het
Rp1l1 T G 14: 64,030,139 L1058R probably damaging Het
Rreb1 A G 13: 37,893,898 S29G probably benign Het
Scube1 C A 15: 83,638,787 R284L possibly damaging Het
Slc13a3 T C 2: 165,430,322 Q267R probably benign Het
Slc5a1 A T 5: 33,160,944 N647I probably damaging Het
Sphk2 A T 7: 45,711,582 S333T probably benign Het
Sptan1 A G 2: 30,000,056 D1050G probably benign Het
Tdo2 G T 3: 81,962,758 A269E probably damaging Het
Tnc A T 4: 64,020,411 C64S probably damaging Het
Trim47 T A 11: 116,107,557 E360D probably damaging Het
Trp53i13 T A 11: 77,508,303 T374S possibly damaging Het
Try5 A G 6: 41,311,814 L157P probably benign Het
Ttn A T 2: 76,747,832 V24239D probably damaging Het
Ttn T C 2: 76,943,323 Y2318C unknown Het
Txn1 T C 4: 57,945,199 D68G possibly damaging Het
Upf3a A G 8: 13,787,418 D121G probably damaging Het
Vmn2r114 T C 17: 23,291,265 Y747C probably damaging Het
Vmn2r68 A G 7: 85,232,379 W498R probably damaging Het
Vwa8 A C 14: 78,982,234 probably null Het
Zp2 A T 7: 120,133,944 F591L probably damaging Het
Other mutations in Lrriq1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00988:Lrriq1 APN 10 103161896 missense probably damaging 0.99
IGL01523:Lrriq1 APN 10 103218116 nonsense probably null
IGL01637:Lrriq1 APN 10 103215628 missense probably benign
IGL02019:Lrriq1 APN 10 103178800 missense probably benign 0.02
IGL02153:Lrriq1 APN 10 103170479 missense probably benign 0.01
IGL02341:Lrriq1 APN 10 103224941 missense probably benign 0.03
IGL02343:Lrriq1 APN 10 103234163 splice site probably benign
IGL02408:Lrriq1 APN 10 103146281 missense probably benign 0.17
IGL02431:Lrriq1 APN 10 103200639 missense probably damaging 1.00
IGL02540:Lrriq1 APN 10 103215019 missense probably benign 0.02
IGL02558:Lrriq1 APN 10 103146283 missense probably damaging 1.00
IGL02613:Lrriq1 APN 10 103144548 missense probably damaging 0.99
IGL02642:Lrriq1 APN 10 103221461 critical splice acceptor site probably null
IGL03027:Lrriq1 APN 10 103227196 missense probably benign 0.35
PIT4362001:Lrriq1 UTSW 10 103071194 missense probably benign 0.26
R0050:Lrriq1 UTSW 10 103068931 missense probably damaging 0.99
R0050:Lrriq1 UTSW 10 103068931 missense probably damaging 0.99
R0068:Lrriq1 UTSW 10 103063418 missense probably benign 0.02
R0068:Lrriq1 UTSW 10 103063418 missense probably benign 0.02
R0124:Lrriq1 UTSW 10 103170420 critical splice donor site probably null
R0244:Lrriq1 UTSW 10 103215773 missense probably damaging 0.98
R0323:Lrriq1 UTSW 10 103221289 missense possibly damaging 0.91
R0515:Lrriq1 UTSW 10 103068968 splice site probably null
R0522:Lrriq1 UTSW 10 103161777 missense probably damaging 0.99
R0701:Lrriq1 UTSW 10 103234044 missense probably benign
R1220:Lrriq1 UTSW 10 103071129 missense probably benign 0.05
R1261:Lrriq1 UTSW 10 103234137 missense possibly damaging 0.87
R1262:Lrriq1 UTSW 10 103234137 missense possibly damaging 0.87
R1451:Lrriq1 UTSW 10 103202515 splice site probably benign
R1642:Lrriq1 UTSW 10 103214456 missense probably benign 0.13
R1643:Lrriq1 UTSW 10 103214824 missense probably benign 0.00
R1647:Lrriq1 UTSW 10 103170648 nonsense probably null
R1830:Lrriq1 UTSW 10 103161759 missense probably benign
R1843:Lrriq1 UTSW 10 103227173 splice site probably null
R2128:Lrriq1 UTSW 10 103214857 missense probably benign 0.01
R2129:Lrriq1 UTSW 10 103214857 missense probably benign 0.01
R2199:Lrriq1 UTSW 10 103068913 missense probably damaging 1.00
R2354:Lrriq1 UTSW 10 103189987 missense probably damaging 1.00
R2495:Lrriq1 UTSW 10 103202381 missense probably damaging 0.97
R2897:Lrriq1 UTSW 10 103227250 missense probably damaging 0.99
R2898:Lrriq1 UTSW 10 103227250 missense probably damaging 0.99
R2922:Lrriq1 UTSW 10 103214675 missense probably benign 0.00
R2939:Lrriq1 UTSW 10 103144889 missense probably damaging 0.98
R2965:Lrriq1 UTSW 10 103214900 missense probably benign 0.07
R2966:Lrriq1 UTSW 10 103214900 missense probably benign 0.07
R3081:Lrriq1 UTSW 10 103144889 missense probably damaging 0.98
R3115:Lrriq1 UTSW 10 103170433 missense probably benign 0.00
R3745:Lrriq1 UTSW 10 103170856 missense probably damaging 0.99
R3813:Lrriq1 UTSW 10 103216111 missense probably damaging 1.00
R3814:Lrriq1 UTSW 10 103216111 missense probably damaging 1.00
R3885:Lrriq1 UTSW 10 103216106 missense probably damaging 0.96
R4378:Lrriq1 UTSW 10 103202364 missense probably damaging 1.00
R4632:Lrriq1 UTSW 10 103221427 missense probably damaging 1.00
R4633:Lrriq1 UTSW 10 103200563 nonsense probably null
R4663:Lrriq1 UTSW 10 103063412 missense possibly damaging 0.88
R4702:Lrriq1 UTSW 10 103215749 missense possibly damaging 0.65
R4793:Lrriq1 UTSW 10 103170466 missense probably benign 0.25
R4801:Lrriq1 UTSW 10 103221318 missense probably benign 0.02
R4802:Lrriq1 UTSW 10 103221318 missense probably benign 0.02
R4815:Lrriq1 UTSW 10 103144878 missense probably benign 0.10
R4872:Lrriq1 UTSW 10 103178788 missense possibly damaging 0.56
R4877:Lrriq1 UTSW 10 103234038 missense possibly damaging 0.88
R4894:Lrriq1 UTSW 10 103161752 missense possibly damaging 0.86
R4990:Lrriq1 UTSW 10 103200559 missense probably damaging 1.00
R4991:Lrriq1 UTSW 10 103200559 missense probably damaging 1.00
R5011:Lrriq1 UTSW 10 103189923 missense probably damaging 1.00
R5013:Lrriq1 UTSW 10 103189923 missense probably damaging 1.00
R5122:Lrriq1 UTSW 10 103187453 missense probably damaging 1.00
R5282:Lrriq1 UTSW 10 103215345 missense probably benign 0.01
R5311:Lrriq1 UTSW 10 103214587 missense probably damaging 1.00
R5567:Lrriq1 UTSW 10 103170596 missense possibly damaging 0.56
R5643:Lrriq1 UTSW 10 103215440 missense probably benign 0.00
R5683:Lrriq1 UTSW 10 103173375 missense probably damaging 1.00
R5916:Lrriq1 UTSW 10 103221382 nonsense probably null
R6008:Lrriq1 UTSW 10 103170464 missense probably damaging 1.00
R6022:Lrriq1 UTSW 10 103215534 missense possibly damaging 0.90
R6224:Lrriq1 UTSW 10 103215757 missense probably damaging 1.00
R6254:Lrriq1 UTSW 10 103215451 missense probably benign 0.15
R6311:Lrriq1 UTSW 10 103173393 missense probably benign 0.03
R6460:Lrriq1 UTSW 10 103200698 missense probably damaging 1.00
R6502:Lrriq1 UTSW 10 103227184 missense probably damaging 0.99
R6637:Lrriq1 UTSW 10 103221432 missense probably benign 0.06
R6719:Lrriq1 UTSW 10 103071116 missense probably damaging 1.00
R6736:Lrriq1 UTSW 10 103181889 critical splice acceptor site probably null
R6928:Lrriq1 UTSW 10 103214939 missense possibly damaging 0.95
R6991:Lrriq1 UTSW 10 103187458 missense probably damaging 1.00
R7174:Lrriq1 UTSW 10 103224965 missense probably benign
R7241:Lrriq1 UTSW 10 103215973 missense probably damaging 1.00
R7248:Lrriq1 UTSW 10 103223750 missense possibly damaging 0.85
R7287:Lrriq1 UTSW 10 103216016 missense probably benign 0.00
R7402:Lrriq1 UTSW 10 103221324 missense possibly damaging 0.87
R7439:Lrriq1 UTSW 10 103214519 missense probably benign 0.21
R7611:Lrriq1 UTSW 10 103200571 missense possibly damaging 0.54
R7634:Lrriq1 UTSW 10 103200601 missense probably damaging 1.00
R7767:Lrriq1 UTSW 10 103215954 missense probably damaging 0.99
R7809:Lrriq1 UTSW 10 103215817 missense probably damaging 0.99
R7910:Lrriq1 UTSW 10 103215194 nonsense probably null
R8131:Lrriq1 UTSW 10 103215711 missense possibly damaging 0.57
R8156:Lrriq1 UTSW 10 103156335 critical splice donor site probably null
R8211:Lrriq1 UTSW 10 103170547 missense probably damaging 1.00
R8304:Lrriq1 UTSW 10 103234068 missense possibly damaging 0.57
R8487:Lrriq1 UTSW 10 103215053 missense probably damaging 0.98
R8500:Lrriq1 UTSW 10 103046155 missense
X0026:Lrriq1 UTSW 10 103215704 nonsense probably null
Z1088:Lrriq1 UTSW 10 103202446 missense probably damaging 1.00
Z1176:Lrriq1 UTSW 10 103202359 missense probably damaging 1.00
Z1176:Lrriq1 UTSW 10 103202360 missense probably damaging 1.00
Z1176:Lrriq1 UTSW 10 103234085 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACTTCTTCAGTGGCCAAGAGG -3'
(R):5'- TGAACAGTACCCGTGGCAAG -3'

Sequencing Primer
(F):5'- GGTTATTAGCACTGTGACTACCAGC -3'
(R):5'- TACCCGTGGCAAGGACTAG -3'
Posted On2019-10-24