Incidental Mutation 'R7585:Cog5'
ID 587080
Institutional Source Beutler Lab
Gene Symbol Cog5
Ensembl Gene ENSMUSG00000035933
Gene Name component of oligomeric golgi complex 5
Synonyms GTC90, GOLTC1, 5430405C01Rik
MMRRC Submission 045635-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.901) question?
Stock # R7585 (G1)
Quality Score 225.009
Status Not validated
Chromosome 12
Chromosomal Location 31704868-31987629 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 31810888 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Lysine at position 194 (I194K)
Ref Sequence ENSEMBL: ENSMUSP00000044797 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036862]
AlphaFold Q8C0L8
Predicted Effect probably damaging
Transcript: ENSMUST00000036862
AA Change: I194K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000044797
Gene: ENSMUSG00000035933
AA Change: I194K

DomainStartEndE-ValueType
low complexity region 9 23 N/A INTRINSIC
Pfam:COG5 35 158 3.8e-37 PFAM
Pfam:Vps51 37 120 1.8e-12 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is one of eight proteins (Cog1-8) which form a Golgi-localized complex (COG) required for normal Golgi morphology and function. The encoded protein is organized with conserved oligomeric Golgi complex components 6, 7 and 8 into a sub-complex referred to as lobe B. Alternative splicing results in multiple transcript variants. Mutations in this gene result in congenital disorder of glycosylation type 2I.[provided by RefSeq, Jan 2011]
Allele List at MGI

All alleles(99) : Gene trapped(99)

Other mutations in this stock
Total: 105 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700034J05Rik T C 6: 146,854,851 (GRCm39) T64A probably benign Het
A930009A15Rik T A 10: 115,414,230 (GRCm39) V52D unknown Het
Aadacl2fm2 C A 3: 59,651,143 (GRCm39) D88E possibly damaging Het
Acacb A G 5: 114,384,073 (GRCm39) I2201V probably damaging Het
Aco2 A C 15: 81,756,685 (GRCm39) probably benign Het
Acod1 C T 14: 103,292,177 (GRCm39) Q234* probably null Het
Actr6 T C 10: 89,561,658 (GRCm39) S163G probably benign Het
Agmat T C 4: 141,477,056 (GRCm39) V154A probably benign Het
Agrn T C 4: 156,255,131 (GRCm39) N1584S probably benign Het
Alg6 A T 4: 99,626,371 (GRCm39) S60C probably damaging Het
Ap5s1 T C 2: 131,054,482 (GRCm39) F98L probably damaging Het
Atp6v1f G A 6: 29,467,927 (GRCm39) V38I possibly damaging Het
B3gnt3 T C 8: 72,145,972 (GRCm39) T186A probably damaging Het
Brpf1 T C 6: 113,292,007 (GRCm39) V351A possibly damaging Het
Cacna1g A G 11: 94,364,368 (GRCm39) S26P probably benign Het
Camta1 G A 4: 151,229,287 (GRCm39) S515L probably damaging Het
Ccdc122 C A 14: 77,329,139 (GRCm39) A64E probably damaging Het
Ccdc89 C A 7: 90,076,510 (GRCm39) T240K possibly damaging Het
Cercam T C 2: 29,771,743 (GRCm39) L521P probably damaging Het
Cfb T C 17: 35,076,737 (GRCm39) N561S probably benign Het
Clk3 T C 9: 57,669,119 (GRCm39) E159G probably damaging Het
Cntf A T 19: 12,741,587 (GRCm39) L91* probably null Het
Cntn4 T A 6: 106,466,572 (GRCm39) I158N probably damaging Het
Col22a1 T A 15: 71,764,054 (GRCm39) D66V probably damaging Het
Crat C T 2: 30,294,577 (GRCm39) R497Q probably benign Het
Csmd3 T C 15: 48,485,471 (GRCm39) T145A possibly damaging Het
D130043K22Rik A G 13: 25,069,568 (GRCm39) I876V probably benign Het
Dlec1 T C 9: 118,971,819 (GRCm39) S1335P probably benign Het
Dnah5 A T 15: 28,402,014 (GRCm39) T3392S probably benign Het
Dnal1 A G 12: 84,171,267 (GRCm39) K21E probably benign Het
Dspp T C 5: 104,323,391 (GRCm39) V178A possibly damaging Het
Dst A G 1: 34,153,096 (GRCm39) D119G possibly damaging Het
Dyrk4 T A 6: 126,867,007 (GRCm39) I342F probably damaging Het
Eif3b A G 5: 140,425,757 (GRCm39) D649G probably damaging Het
Exoc7 T C 11: 116,191,124 (GRCm39) D259G probably benign Het
Fancm T C 12: 65,153,021 (GRCm39) V1159A possibly damaging Het
Fat3 T C 9: 15,909,558 (GRCm39) D2148G probably benign Het
Fdps C A 3: 89,001,113 (GRCm39) R300L probably benign Het
Gfm2 T C 13: 97,315,540 (GRCm39) L736P probably benign Het
Grin2b T A 6: 135,756,301 (GRCm39) T475S probably damaging Het
H2-M3 T G 17: 37,581,599 (GRCm39) L87R probably damaging Het
Hao1 T A 2: 134,343,076 (GRCm39) I272F probably damaging Het
Hapln2 C T 3: 87,929,980 (GRCm39) G299S probably damaging Het
Hdac3 A T 18: 38,078,408 (GRCm39) I154N probably damaging Het
Herc1 A G 9: 66,352,829 (GRCm39) D2105G probably damaging Het
Kcna2 T C 3: 107,012,658 (GRCm39) F413S probably damaging Het
Kctd13 A G 7: 126,528,458 (GRCm39) T78A possibly damaging Het
Kif20a A G 18: 34,758,591 (GRCm39) D20G probably benign Het
Kif26b A T 1: 178,744,061 (GRCm39) I1386F probably benign Het
Klc4 T A 17: 46,942,810 (GRCm39) M585L probably benign Het
Lrp4 A G 2: 91,322,933 (GRCm39) Y1139C probably damaging Het
Lrp5 A T 19: 3,654,094 (GRCm39) I1111N possibly damaging Het
Lrriq1 A T 10: 103,050,807 (GRCm39) D648E possibly damaging Het
Mmp2 G A 8: 93,563,564 (GRCm39) G346D probably damaging Het
Mrgpra4 T A 7: 47,631,377 (GRCm39) I75L probably benign Het
Muc4 T A 16: 32,586,076 (GRCm39) V537D Het
Myh2 T A 11: 67,070,237 (GRCm39) probably null Het
Myrf T C 19: 10,194,091 (GRCm39) T487A probably damaging Het
Nalcn A T 14: 123,753,050 (GRCm39) L312H probably damaging Het
Nop14 G A 5: 34,802,124 (GRCm39) P560L probably damaging Het
Nufip1 C G 14: 76,348,427 (GRCm39) P19A probably benign Het
Oosp3 G T 19: 11,678,322 (GRCm39) M99I probably benign Het
Or14c40 T C 7: 86,313,880 (GRCm39) *337Q probably null Het
Or4c52 A T 2: 89,845,393 (GRCm39) I40F probably damaging Het
Or4x13 T A 2: 90,231,367 (GRCm39) Y121N probably damaging Het
Or51aa5 C A 7: 103,167,166 (GRCm39) V142L possibly damaging Het
Or51k2 A G 7: 103,596,607 (GRCm39) N278S probably benign Het
Or52n4b C A 7: 108,144,598 (GRCm39) P289T probably damaging Het
Or6b2b A G 1: 92,419,042 (GRCm39) V145A probably benign Het
Or7e175 T C 9: 20,040,307 (GRCm39) Het
Panx2 A G 15: 88,952,169 (GRCm39) K212R probably damaging Het
Paxip1 A C 5: 27,977,002 (GRCm39) H353Q unknown Het
Pbx4 C A 8: 70,285,475 (GRCm39) D39E probably damaging Het
Phc2 G A 4: 128,604,932 (GRCm39) A223T probably benign Het
Plcl1 A G 1: 55,445,608 (GRCm39) D21G probably benign Het
Plec G A 15: 76,057,632 (GRCm39) R4102W probably damaging Het
Plekhh2 A G 17: 84,884,608 (GRCm39) Y774C probably benign Het
Polr2a A T 11: 69,630,828 (GRCm39) Y1197N probably damaging Het
Psmg4 A T 13: 34,347,195 (GRCm39) H46L probably benign Het
Ptprk A G 10: 28,436,084 (GRCm39) Y815C probably damaging Het
Qrich2 T C 11: 116,346,547 (GRCm39) I1426V probably benign Het
Rbm43 T C 2: 51,816,763 (GRCm39) D68G probably benign Het
Rgs6 T C 12: 83,153,644 (GRCm39) S360P probably damaging Het
Rp1l1 T G 14: 64,267,588 (GRCm39) L1058R probably damaging Het
Rreb1 A G 13: 38,077,874 (GRCm39) S29G probably benign Het
Scube1 C A 15: 83,522,988 (GRCm39) R284L possibly damaging Het
Serpinb9h G T 13: 33,588,299 (GRCm39) D295Y probably benign Het
Slc13a3 T C 2: 165,272,242 (GRCm39) Q267R probably benign Het
Slc49a3 T C 5: 108,596,685 (GRCm39) T16A probably benign Het
Slc5a1 A T 5: 33,318,288 (GRCm39) N647I probably damaging Het
Sphk2 A T 7: 45,361,006 (GRCm39) S333T probably benign Het
Sptan1 A G 2: 29,890,068 (GRCm39) D1050G probably benign Het
Tdo2 G T 3: 81,870,065 (GRCm39) A269E probably damaging Het
Tnc A T 4: 63,938,648 (GRCm39) C64S probably damaging Het
Trim47 T A 11: 115,998,383 (GRCm39) E360D probably damaging Het
Trp53i13 T A 11: 77,399,129 (GRCm39) T374S possibly damaging Het
Try5 A G 6: 41,288,748 (GRCm39) L157P probably benign Het
Ttn A T 2: 76,578,176 (GRCm39) V24239D probably damaging Het
Ttn T C 2: 76,773,667 (GRCm39) Y2318C unknown Het
Txn1 T C 4: 57,945,199 (GRCm39) D68G possibly damaging Het
Upf3a A G 8: 13,837,418 (GRCm39) D121G probably damaging Het
Vmn2r114 T C 17: 23,510,239 (GRCm39) Y747C probably damaging Het
Vmn2r68 A G 7: 84,881,587 (GRCm39) W498R probably damaging Het
Vwa8 A C 14: 79,219,674 (GRCm39) probably null Het
Zp2 A T 7: 119,733,167 (GRCm39) F591L probably damaging Het
Other mutations in Cog5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00433:Cog5 APN 12 31,735,703 (GRCm39) missense probably damaging 1.00
IGL00495:Cog5 APN 12 31,887,308 (GRCm39) missense probably benign 0.06
IGL00763:Cog5 APN 12 31,715,531 (GRCm39) splice site probably benign
IGL00789:Cog5 APN 12 31,810,951 (GRCm39) missense possibly damaging 0.95
IGL01288:Cog5 APN 12 31,936,205 (GRCm39) missense probably benign 0.13
IGL01315:Cog5 APN 12 31,810,985 (GRCm39) splice site probably benign
IGL01396:Cog5 APN 12 31,944,095 (GRCm39) missense probably benign 0.01
IGL02468:Cog5 APN 12 31,887,357 (GRCm39) critical splice donor site probably null
IGL03030:Cog5 APN 12 31,840,921 (GRCm39) missense probably damaging 0.99
IGL03346:Cog5 APN 12 31,944,037 (GRCm39) missense possibly damaging 0.88
R0201:Cog5 UTSW 12 31,889,840 (GRCm39) missense probably damaging 0.99
R0356:Cog5 UTSW 12 31,887,180 (GRCm39) splice site probably benign
R0492:Cog5 UTSW 12 31,919,460 (GRCm39) missense probably damaging 1.00
R0646:Cog5 UTSW 12 31,887,358 (GRCm39) splice site probably benign
R0971:Cog5 UTSW 12 31,969,677 (GRCm39) missense probably benign 0.11
R1158:Cog5 UTSW 12 31,920,056 (GRCm39) splice site probably benign
R1997:Cog5 UTSW 12 31,710,848 (GRCm39) missense possibly damaging 0.66
R2167:Cog5 UTSW 12 31,887,288 (GRCm39) missense probably damaging 0.99
R4414:Cog5 UTSW 12 31,710,853 (GRCm39) nonsense probably null
R4755:Cog5 UTSW 12 31,919,405 (GRCm39) splice site probably null
R4836:Cog5 UTSW 12 31,969,732 (GRCm39) missense probably benign 0.07
R5017:Cog5 UTSW 12 31,970,604 (GRCm39) missense probably benign 0.29
R5256:Cog5 UTSW 12 31,936,204 (GRCm39) missense probably benign
R5986:Cog5 UTSW 12 31,710,716 (GRCm39) missense probably benign 0.03
R6131:Cog5 UTSW 12 31,936,220 (GRCm39) missense possibly damaging 0.47
R6885:Cog5 UTSW 12 31,944,198 (GRCm39) missense probably damaging 1.00
R7056:Cog5 UTSW 12 31,715,468 (GRCm39) missense possibly damaging 0.65
R7177:Cog5 UTSW 12 31,810,888 (GRCm39) missense probably damaging 1.00
R7182:Cog5 UTSW 12 31,735,707 (GRCm39) missense probably damaging 1.00
R7418:Cog5 UTSW 12 31,883,240 (GRCm39) missense probably damaging 1.00
R7445:Cog5 UTSW 12 31,969,671 (GRCm39) missense possibly damaging 0.64
R8332:Cog5 UTSW 12 31,883,222 (GRCm39) nonsense probably null
R8722:Cog5 UTSW 12 31,969,703 (GRCm39) missense possibly damaging 0.82
R8781:Cog5 UTSW 12 31,883,249 (GRCm39) missense probably damaging 1.00
R8911:Cog5 UTSW 12 31,883,238 (GRCm39) missense probably damaging 1.00
R8979:Cog5 UTSW 12 31,840,894 (GRCm39) missense probably benign 0.00
R9153:Cog5 UTSW 12 31,710,810 (GRCm39) missense possibly damaging 0.87
X0062:Cog5 UTSW 12 31,735,691 (GRCm39) missense probably benign 0.01
Z1177:Cog5 UTSW 12 31,851,984 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCAGCATTTGGGAGACAGAG -3'
(R):5'- TCCTCCATGATAAAACTCACCTATG -3'

Sequencing Primer
(F):5'- GAGTTCCAGGACTGTCTGCTC -3'
(R):5'- CACCTATGTATGACCGTGAATGC -3'
Posted On 2019-10-24