Incidental Mutation 'R7585:D130043K22Rik'
ID 587084
Institutional Source Beutler Lab
Gene Symbol D130043K22Rik
Ensembl Gene ENSMUSG00000006711
Gene Name RIKEN cDNA D130043K22 gene
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R7585 (G1)
Quality Score 225.009
Status Not validated
Chromosome 13
Chromosomal Location 24845135-24901270 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 24885585 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 876 (I876V)
Ref Sequence ENSEMBL: ENSMUSP00000006893 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006893] [ENSMUST00000141572]
AlphaFold Q5SZV5
Predicted Effect probably benign
Transcript: ENSMUST00000006893
AA Change: I876V

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000006893
Gene: ENSMUSG00000006711
AA Change: I876V

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Blast:MANEC 23 102 3e-44 BLAST
low complexity region 236 270 N/A INTRINSIC
FN3 332 427 3.43e1 SMART
PKD 345 436 3.96e0 SMART
FN3 435 521 3.08e1 SMART
PKD 444 533 7.12e-10 SMART
PKD 539 629 1.46e-6 SMART
PKD 630 723 6.75e-11 SMART
FN3 634 711 5.1e1 SMART
FN3 728 808 9.15e1 SMART
PKD 729 820 4.38e-10 SMART
transmembrane domain 965 987 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000141572
SMART Domains Protein: ENSMUSP00000116004
Gene: ENSMUSG00000006711

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Blast:MANEC 23 102 2e-44 BLAST
low complexity region 236 270 N/A INTRINSIC
FN3 332 427 3.43e1 SMART
PKD 345 436 3.96e0 SMART
FN3 435 521 3.08e1 SMART
PKD 444 533 7.12e-10 SMART
PKD 539 629 1.46e-6 SMART
PKD 630 723 6.75e-11 SMART
FN3 634 711 5.1e1 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a transmembrane protein that contains a large extracellular domain with multiple polycystic kidney disease (PKD) domains. The encoded protein may play a role in the development of the cerebral cortex by regulating neuronal migration and cell adhesion. Single nucleotide polymorphisms in a similar gene in human are associated with dyslexia. Alternatively spliced transcript variants have been identifed. [provided by RefSeq, May 2015]
PHENOTYPE: Homozygous knockout results in a mild behavioral phenotype: increased prepulse inhibition in males under certain conditions and decreased anxiety-related response. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 105 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700034J05Rik T C 6: 146,953,353 T64A probably benign Het
A930009A15Rik T A 10: 115,578,325 V52D unknown Het
Acacb A G 5: 114,246,012 I2201V probably damaging Het
Aco2 A C 15: 81,872,484 probably benign Het
Acod1 C T 14: 103,054,741 Q234* probably null Het
Actr6 T C 10: 89,725,796 S163G probably benign Het
Agmat T C 4: 141,749,745 V154A probably benign Het
Agrn T C 4: 156,170,674 N1584S probably benign Het
Alg6 A T 4: 99,738,134 S60C probably damaging Het
Ap5s1 T C 2: 131,212,562 F98L probably damaging Het
Atp6v1f G A 6: 29,467,928 V38I possibly damaging Het
B3gnt3 T C 8: 71,693,328 T186A probably damaging Het
Brpf1 T C 6: 113,315,046 V351A possibly damaging Het
Cacna1g A G 11: 94,473,542 S26P probably benign Het
Camta1 G A 4: 151,144,830 S515L probably damaging Het
Ccdc122 C A 14: 77,091,699 A64E probably damaging Het
Ccdc89 C A 7: 90,427,302 T240K possibly damaging Het
Cercam T C 2: 29,881,731 L521P probably damaging Het
Cfb T C 17: 34,857,761 N561S probably benign Het
Clk3 T C 9: 57,761,836 E159G probably damaging Het
Cntf A T 19: 12,764,223 L91* probably null Het
Cntn4 T A 6: 106,489,611 I158N probably damaging Het
Cog5 T A 12: 31,760,889 I194K probably damaging Het
Col22a1 T A 15: 71,892,205 D66V probably damaging Het
Crat C T 2: 30,404,565 R497Q probably benign Het
Csmd3 T C 15: 48,622,075 T145A possibly damaging Het
Dlec1 T C 9: 119,142,751 S1335P probably benign Het
Dnah5 A T 15: 28,401,868 T3392S probably benign Het
Dnal1 A G 12: 84,124,493 K21E probably benign Het
Dspp T C 5: 104,175,525 V178A possibly damaging Het
Dst A G 1: 34,114,015 D119G possibly damaging Het
Dyrk4 T A 6: 126,890,044 I342F probably damaging Het
Eif3b A G 5: 140,440,002 D649G probably damaging Het
Exoc7 T C 11: 116,300,298 D259G probably benign Het
Fancm T C 12: 65,106,247 V1159A possibly damaging Het
Fat3 T C 9: 15,998,262 D2148G probably benign Het
Fdps C A 3: 89,093,806 R300L probably benign Het
Gfm2 T C 13: 97,179,032 L736P probably benign Het
Gm11397 G T 13: 33,404,316 D295Y probably benign Het
Gm5538 C A 3: 59,743,722 D88E possibly damaging Het
Grin2b T A 6: 135,779,303 T475S probably damaging Het
H2-M3 T G 17: 37,270,708 L87R probably damaging Het
Hao1 T A 2: 134,501,156 I272F probably damaging Het
Hapln2 C T 3: 88,022,673 G299S probably damaging Het
Hdac3 A T 18: 37,945,355 I154N probably damaging Het
Herc1 A G 9: 66,445,547 D2105G probably damaging Het
Kcna2 T C 3: 107,105,342 F413S probably damaging Het
Kctd13 A G 7: 126,929,286 T78A possibly damaging Het
Kif20a A G 18: 34,625,538 D20G probably benign Het
Kif26b A T 1: 178,916,496 I1386F probably benign Het
Klc4 T A 17: 46,631,884 M585L probably benign Het
Lrp4 A G 2: 91,492,588 Y1139C probably damaging Het
Lrp5 A T 19: 3,604,094 I1111N possibly damaging Het
Lrriq1 A T 10: 103,214,946 D648E possibly damaging Het
Mfsd7a T C 5: 108,448,819 T16A probably benign Het
Mmp2 G A 8: 92,836,936 G346D probably damaging Het
Mrgpra4 T A 7: 47,981,629 I75L probably benign Het
Muc4 T A 16: 32,765,702 V537D Het
Myh2 T A 11: 67,179,411 probably null Het
Myrf T C 19: 10,216,727 T487A probably damaging Het
Nalcn A T 14: 123,515,638 L312H probably damaging Het
Nop14 G A 5: 34,644,780 P560L probably damaging Het
Nufip1 C G 14: 76,110,987 P19A probably benign Het
Olfr1263 A T 2: 90,015,049 I40F probably damaging Het
Olfr1274-ps T A 2: 90,401,023 Y121N probably damaging Het
Olfr1415 A G 1: 92,491,320 V145A probably benign Het
Olfr293 T C 7: 86,664,672 *337Q probably null Het
Olfr503 C A 7: 108,545,391 P289T probably damaging Het
Olfr611 C A 7: 103,517,959 V142L possibly damaging Het
Olfr633 A G 7: 103,947,400 N278S probably benign Het
Olfr869 T C 9: 20,129,011 Het
Oosp3 G T 19: 11,700,958 M99I probably benign Het
Panx2 A G 15: 89,067,966 K212R probably damaging Het
Paxip1 A C 5: 27,772,004 H353Q unknown Het
Pbx4 C A 8: 69,832,825 D39E probably damaging Het
Phc2 G A 4: 128,711,139 A223T probably benign Het
Plcl1 A G 1: 55,406,449 D21G probably benign Het
Plec G A 15: 76,173,432 R4102W probably damaging Het
Plekhh2 A G 17: 84,577,180 Y774C probably benign Het
Polr2a A T 11: 69,740,002 Y1197N probably damaging Het
Psmg4 A T 13: 34,163,212 H46L probably benign Het
Ptprk A G 10: 28,560,088 Y815C probably damaging Het
Qrich2 T C 11: 116,455,721 I1426V probably benign Het
Rbm43 T C 2: 51,926,751 D68G probably benign Het
Rgs6 T C 12: 83,106,870 S360P probably damaging Het
Rp1l1 T G 14: 64,030,139 L1058R probably damaging Het
Rreb1 A G 13: 37,893,898 S29G probably benign Het
Scube1 C A 15: 83,638,787 R284L possibly damaging Het
Slc13a3 T C 2: 165,430,322 Q267R probably benign Het
Slc5a1 A T 5: 33,160,944 N647I probably damaging Het
Sphk2 A T 7: 45,711,582 S333T probably benign Het
Sptan1 A G 2: 30,000,056 D1050G probably benign Het
Tdo2 G T 3: 81,962,758 A269E probably damaging Het
Tnc A T 4: 64,020,411 C64S probably damaging Het
Trim47 T A 11: 116,107,557 E360D probably damaging Het
Trp53i13 T A 11: 77,508,303 T374S possibly damaging Het
Try5 A G 6: 41,311,814 L157P probably benign Het
Ttn A T 2: 76,747,832 V24239D probably damaging Het
Ttn T C 2: 76,943,323 Y2318C unknown Het
Txn1 T C 4: 57,945,199 D68G possibly damaging Het
Upf3a A G 8: 13,787,418 D121G probably damaging Het
Vmn2r114 T C 17: 23,291,265 Y747C probably damaging Het
Vmn2r68 A G 7: 85,232,379 W498R probably damaging Het
Vwa8 A C 14: 78,982,234 probably null Het
Zp2 A T 7: 120,133,944 F591L probably damaging Het
Other mutations in D130043K22Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00850:D130043K22Rik APN 13 24867174 missense probably damaging 1.00
IGL01114:D130043K22Rik APN 13 24857156 missense probably damaging 0.99
IGL01412:D130043K22Rik APN 13 24887860 missense probably damaging 1.00
IGL01542:D130043K22Rik APN 13 24876037 splice site probably null
IGL01615:D130043K22Rik APN 13 24899796 missense probably damaging 1.00
IGL01705:D130043K22Rik APN 13 24857941 missense probably benign 0.00
IGL02220:D130043K22Rik APN 13 24883755 missense possibly damaging 0.95
IGL02229:D130043K22Rik APN 13 24875924 missense probably damaging 1.00
IGL02576:D130043K22Rik APN 13 24856870 missense possibly damaging 0.74
IGL03038:D130043K22Rik APN 13 24879619 missense probably damaging 1.00
IGL03117:D130043K22Rik APN 13 24889842 missense probably damaging 1.00
IGL03014:D130043K22Rik UTSW 13 24858092 missense possibly damaging 0.88
R0019:D130043K22Rik UTSW 13 24880812 missense probably damaging 1.00
R0019:D130043K22Rik UTSW 13 24880812 missense probably damaging 1.00
R0020:D130043K22Rik UTSW 13 24854492 utr 5 prime probably benign
R0172:D130043K22Rik UTSW 13 24872406 missense probably benign 0.16
R0276:D130043K22Rik UTSW 13 24858045 missense possibly damaging 0.92
R0304:D130043K22Rik UTSW 13 24864815 missense probably benign 0.07
R0335:D130043K22Rik UTSW 13 24887877 missense probably damaging 0.98
R0744:D130043K22Rik UTSW 13 24863580 splice site probably benign
R0833:D130043K22Rik UTSW 13 24863580 splice site probably benign
R0836:D130043K22Rik UTSW 13 24863580 splice site probably benign
R1270:D130043K22Rik UTSW 13 24857338 missense probably benign 0.00
R1433:D130043K22Rik UTSW 13 24871341 missense probably damaging 1.00
R1682:D130043K22Rik UTSW 13 24882556 missense probably damaging 1.00
R1772:D130043K22Rik UTSW 13 24875999 missense probably damaging 1.00
R1773:D130043K22Rik UTSW 13 24882602 missense possibly damaging 0.80
R1800:D130043K22Rik UTSW 13 24883894 missense probably damaging 1.00
R1956:D130043K22Rik UTSW 13 24885595 missense probably damaging 1.00
R2255:D130043K22Rik UTSW 13 24856911 missense probably damaging 1.00
R2445:D130043K22Rik UTSW 13 24857036 missense probably benign 0.04
R2568:D130043K22Rik UTSW 13 24883891 missense probably damaging 0.97
R4160:D130043K22Rik UTSW 13 24862696 missense probably benign 0.02
R4494:D130043K22Rik UTSW 13 24871356 missense probably benign 0.16
R4732:D130043K22Rik UTSW 13 24899665 missense probably damaging 1.00
R4733:D130043K22Rik UTSW 13 24899665 missense probably damaging 1.00
R4782:D130043K22Rik UTSW 13 24878040 missense probably damaging 1.00
R4799:D130043K22Rik UTSW 13 24878040 missense probably damaging 1.00
R4864:D130043K22Rik UTSW 13 24863612 missense probably damaging 1.00
R5155:D130043K22Rik UTSW 13 24872290 missense probably damaging 1.00
R5240:D130043K22Rik UTSW 13 24877977 missense probably damaging 1.00
R5383:D130043K22Rik UTSW 13 24857414 missense probably benign 0.02
R5493:D130043K22Rik UTSW 13 24863603 missense probably damaging 1.00
R6184:D130043K22Rik UTSW 13 24885591 missense probably damaging 1.00
R6305:D130043K22Rik UTSW 13 24885685 missense probably damaging 1.00
R6436:D130043K22Rik UTSW 13 24877935 missense probably damaging 1.00
R6980:D130043K22Rik UTSW 13 24864781 missense probably damaging 0.98
R7038:D130043K22Rik UTSW 13 24893408 missense probably damaging 1.00
R7085:D130043K22Rik UTSW 13 24872302 missense possibly damaging 0.95
R7147:D130043K22Rik UTSW 13 24882563 missense probably benign 0.31
R7384:D130043K22Rik UTSW 13 24882605 missense probably damaging 1.00
R7398:D130043K22Rik UTSW 13 24893377 missense probably damaging 0.97
R7584:D130043K22Rik UTSW 13 24872370 missense probably damaging 1.00
R7588:D130043K22Rik UTSW 13 24887893 missense probably damaging 0.99
R7610:D130043K22Rik UTSW 13 24876002 missense probably benign 0.30
R7903:D130043K22Rik UTSW 13 24876012 missense probably damaging 0.98
R7966:D130043K22Rik UTSW 13 24893423 missense probably damaging 1.00
R8014:D130043K22Rik UTSW 13 24856702 missense probably damaging 1.00
R8374:D130043K22Rik UTSW 13 24857979 missense probably benign 0.07
R8543:D130043K22Rik UTSW 13 24889869 missense probably benign 0.08
R8775:D130043K22Rik UTSW 13 24856999 nonsense probably null
R8775-TAIL:D130043K22Rik UTSW 13 24856999 nonsense probably null
R8806:D130043K22Rik UTSW 13 24899635 missense probably benign 0.11
R8916:D130043K22Rik UTSW 13 24872271 missense probably benign
R9209:D130043K22Rik UTSW 13 24857107 missense possibly damaging 0.96
R9524:D130043K22Rik UTSW 13 24887893 missense possibly damaging 0.89
Z1177:D130043K22Rik UTSW 13 24856709 missense probably damaging 1.00
Z1177:D130043K22Rik UTSW 13 24856834 missense probably benign 0.39
Z1177:D130043K22Rik UTSW 13 24872248 missense possibly damaging 0.79
Z1177:D130043K22Rik UTSW 13 24880847 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTTGACCTTTGACATCCACATCTAC -3'
(R):5'- CGTCCATGGTTAGCATGTCTG -3'

Sequencing Primer
(F):5'- TTTGACATCCACATCTACACCCC -3'
(R):5'- AGCATGTCTGACTGTTTTATTATGG -3'
Posted On 2019-10-24