Incidental Mutation 'R7586:Gtf3c3'
ID587117
Institutional Source Beutler Lab
Gene Symbol Gtf3c3
Ensembl Gene ENSMUSG00000041303
Gene Namegeneral transcription factor IIIC, polypeptide 3
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.957) question?
Stock #R7586 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location54396004-54438971 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 54403593 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 764 (L764P)
Ref Sequence ENSEMBL: ENSMUSP00000039420 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041638]
Predicted Effect probably damaging
Transcript: ENSMUST00000041638
AA Change: L764P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000039420
Gene: ENSMUSG00000041303
AA Change: L764P

DomainStartEndE-ValueType
low complexity region 18 34 N/A INTRINSIC
low complexity region 92 108 N/A INTRINSIC
TPR 145 178 9.24e1 SMART
TPR 179 212 2.36e1 SMART
TPR 213 246 4.58e-4 SMART
TPR 247 280 6.4e1 SMART
Blast:TPR 286 319 6e-9 BLAST
low complexity region 353 365 N/A INTRINSIC
TPR 452 485 1.87e1 SMART
low complexity region 549 560 N/A INTRINSIC
TPR 807 840 3.27e0 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is part of the TFIIIC2 complex, which binds to the promoters of small nuclear and cytoplasmic RNA genes in order to recruit RNA polymerase III. The TFIIIC2 complex is composed of six subunits. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik A T 6: 149,326,793 N446Y possibly damaging Het
Ankdd1a C T 9: 65,502,184 probably null Het
Ankrd31 A G 13: 96,832,054 E733G possibly damaging Het
Cars2 C T 8: 11,530,321 W239* probably null Het
Catsperz A T 19: 6,922,561 L192* probably null Het
Cdh3 T C 8: 106,511,343 probably null Het
Cfh C T 1: 140,147,721 V260M probably damaging Het
Clcn4 T A 7: 7,293,959 S227C probably benign Het
Cntn3 A T 6: 102,420,427 W62R probably damaging Het
Col27a1 C A 4: 63,225,041 A322D probably damaging Het
Egflam C T 15: 7,208,601 G934S probably damaging Het
Eloa A G 4: 136,007,199 V665A probably damaging Het
Epg5 A G 18: 78,030,060 T2433A probably benign Het
Ercc5 A G 1: 44,175,851 N848S possibly damaging Het
Fbrsl1 A C 5: 110,378,154 F61V probably damaging Het
Fry T C 5: 150,426,218 Y1595H probably damaging Het
Fstl4 A G 11: 53,072,429 N213D probably benign Het
Gab2 C T 7: 97,301,438 P446L probably damaging Het
Ganab A T 19: 8,911,352 Y552F possibly damaging Het
Gfy C T 7: 45,177,538 R378Q probably damaging Het
Gm3285 T C 10: 77,862,041 V8A unknown Het
Gm8251 G A 1: 44,060,013 R642W probably benign Het
Grip1 A T 10: 120,077,138 probably null Het
Igfbp2 A T 1: 72,849,148 M150L probably benign Het
Jakmip2 C T 18: 43,540,611 R796Q probably damaging Het
Jpt1 T A 11: 115,498,195 R141W probably damaging Het
Junb T C 8: 84,978,173 E86G probably damaging Het
Klhl41 A T 2: 69,674,724 D457V probably benign Het
Lama2 T C 10: 27,101,393 Y1930C probably benign Het
Med13 A T 11: 86,271,002 I2167N probably damaging Het
Msh3 A G 13: 92,349,332 probably benign Het
Myo1b A C 1: 51,778,324 I593S probably damaging Het
Myo1c A T 11: 75,657,519 T16S possibly damaging Het
Ndufaf4 C T 4: 24,901,829 L126F probably damaging Het
Nlrp9a A T 7: 26,557,296 N113I possibly damaging Het
Olfr1000 G C 2: 85,608,184 S242C probably damaging Het
Olfr1173 T A 2: 88,274,450 I200F probably damaging Het
Olfr478 T A 7: 108,031,921 T141S probably benign Het
Pabpc6 A T 17: 9,668,682 D313E probably damaging Het
Pcdhb2 G T 18: 37,295,804 G277* probably null Het
Phkb T G 8: 86,029,597 V840G probably damaging Het
Pip4k2c A G 10: 127,199,086 F415S probably damaging Het
Ptprb A G 10: 116,343,874 E1112G probably damaging Het
Pum2 A G 12: 8,747,206 D847G probably damaging Het
Qrich2 C T 11: 116,455,624 R1458H probably benign Het
Rdh11 T C 12: 79,185,183 Y199C probably damaging Het
Scamp3 A G 3: 89,180,366 Y171C probably damaging Het
Serpinb9b T C 13: 33,039,760 S312P probably damaging Het
Slain2 G A 5: 72,965,822 S461N probably benign Het
Slc23a1 G A 18: 35,625,838 T100I probably damaging Het
Spata31d1b T A 13: 59,718,380 I1114N probably damaging Het
Spinkl A G 18: 44,174,589 S2P probably damaging Het
Srrt T C 5: 137,302,195 N173S probably damaging Het
Stk24 C T 14: 121,302,287 A166T probably damaging Het
Supt16 A T 14: 52,173,556 V697E probably damaging Het
Taf6l C T 19: 8,783,846 E53K probably damaging Het
Tmem81 A T 1: 132,507,773 I106F probably damaging Het
Tnxb C A 17: 34,716,408 L2561I probably damaging Het
Top3b G A 16: 16,891,368 R640H probably benign Het
Trpm7 A T 2: 126,810,165 S1463T probably benign Het
Ttll3 CAAAGTAA CAAAGTAAAGTAA 6: 113,399,157 probably null Het
Tubal3 A C 13: 3,928,198 D38A possibly damaging Het
Vps13a T A 19: 16,647,598 I2766F probably benign Het
Wwc1 A T 11: 35,844,195 V951E possibly damaging Het
Zfp777 A T 6: 48,029,218 M414K probably benign Het
Other mutations in Gtf3c3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00428:Gtf3c3 APN 1 54415955 missense probably damaging 0.99
IGL00435:Gtf3c3 APN 1 54427535 missense possibly damaging 0.73
IGL01128:Gtf3c3 APN 1 54428876 missense possibly damaging 0.91
R0243:Gtf3c3 UTSW 1 54403536 missense possibly damaging 0.60
R0271:Gtf3c3 UTSW 1 54428812 missense possibly damaging 0.96
R0571:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R0965:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R0968:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1069:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1070:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1111:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1112:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1113:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1114:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1115:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1117:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1118:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1119:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1228:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1230:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1231:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1313:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1313:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1382:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1394:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1395:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1397:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1414:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1430:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1432:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1473:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1497:Gtf3c3 UTSW 1 54437939 missense probably benign
R1556:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1563:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1638:Gtf3c3 UTSW 1 54405119 missense probably damaging 1.00
R1695:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1716:Gtf3c3 UTSW 1 54399260 missense probably damaging 1.00
R1745:Gtf3c3 UTSW 1 54434212 missense probably damaging 1.00
R1767:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1799:Gtf3c3 UTSW 1 54420424 missense possibly damaging 0.82
R1861:Gtf3c3 UTSW 1 54438838 missense possibly damaging 0.87
R1940:Gtf3c3 UTSW 1 54428958 splice site probably benign
R3804:Gtf3c3 UTSW 1 54424007 critical splice donor site probably null
R4496:Gtf3c3 UTSW 1 54424132 missense probably benign 0.03
R4621:Gtf3c3 UTSW 1 54419416 missense probably damaging 1.00
R5131:Gtf3c3 UTSW 1 54419498 synonymous probably null
R5320:Gtf3c3 UTSW 1 54405873 missense probably damaging 1.00
R5605:Gtf3c3 UTSW 1 54415926 missense probably benign 0.06
R5854:Gtf3c3 UTSW 1 54419437 missense probably benign 0.01
R6050:Gtf3c3 UTSW 1 54406070 missense probably benign 0.00
R6441:Gtf3c3 UTSW 1 54406038 missense probably benign 0.03
R6892:Gtf3c3 UTSW 1 54415941 missense probably benign 0.00
R7114:Gtf3c3 UTSW 1 54423507 missense probably benign
R7299:Gtf3c3 UTSW 1 54417708 missense probably benign 0.01
R7441:Gtf3c3 UTSW 1 54420448 missense probably benign 0.00
R7615:Gtf3c3 UTSW 1 54423572 missense possibly damaging 0.49
R7634:Gtf3c3 UTSW 1 54419641 intron probably null
R7739:Gtf3c3 UTSW 1 54405039 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- CAGGCATTGCTTTTGAAACCAG -3'
(R):5'- CATCAGGAGACACTTAATGAGGATAC -3'

Sequencing Primer
(F):5'- TTACCTGCACAGTCAGAG -3'
(R):5'- CATCGGATCCCAGTACAGATGGTTG -3'
Posted On2019-10-24