Mutagenetix > Incidental Mutations

Incidental Mutation 'R7586:Klhl41'

587121

Institutional Source

Beutler Lab

Gene Symbol

Klhl41

Ensembl Gene

ENSMUSG00000075307

Gene Name

kelch-like 41

Synonyms

LOC228003, Kbtbd10

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.087) question?

Stock #

R7586 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

69670120-69684230 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 69674724 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Valine at position 457 (D457V)

Ref Sequence

ENSEMBL: ENSMUSP00000097627 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000100050]

Predicted Effect

probably benign
Transcript: ENSMUST00000100050
AA Change: D457V

PolyPhen 2 Score 0.334 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000097627
Gene: ENSMUSG00000075307
AA Change: D457V

Domain	Start	End	E-Value	Type
BTB	33	130	8.34e-27	SMART
BACK	135	237	9.67e-36	SMART
Kelch	346	398	6.71e-1	SMART
Kelch	399	447	1.56e-5	SMART
Kelch	448	495	2.43e-7	SMART
Kelch	496	542	5.81e-5	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the kelch-like family. The encoded protein contains a BACK domain, a BTB/POZ domain, and 5 Kelch repeats. This protein is thought to function in skeletal muscle development and maintenance. Mutations in this gene have been associated with nemaline myopathy (NM), a rare congenital muscle disorder. [provided by RefSeq, Mar 2015]
PHENOTYPE: The gene product is involved in stabilizing proteins involved in muscle function. Homozygous knockout affects the structure of muscle fibers and their sarcomeres, resulting in neonatal death. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2810474O19Rik	A	T	6: 149,326,793	N446Y	possibly damaging	Het
Ankdd1a	C	T	9: 65,502,184		probably null	Het
Ankrd31	A	G	13: 96,832,054	E733G	possibly damaging	Het
Cars2	C	T	8: 11,530,321	W239*	probably null	Het
Catsperz	A	T	19: 6,922,561	L192*	probably null	Het
Cdh3	T	C	8: 106,511,343		probably null	Het
Cfh	C	T	1: 140,147,721	V260M	probably damaging	Het
Clcn4	T	A	7: 7,293,959	S227C	probably benign	Het
Cntn3	A	T	6: 102,420,427	W62R	probably damaging	Het
Col27a1	C	A	4: 63,225,041	A322D	probably damaging	Het
Egflam	C	T	15: 7,208,601	G934S	probably damaging	Het
Eloa	A	G	4: 136,007,199	V665A	probably damaging	Het
Epg5	A	G	18: 78,030,060	T2433A	probably benign	Het
Ercc5	A	G	1: 44,175,851	N848S	possibly damaging	Het
Fbrsl1	A	C	5: 110,378,154	F61V	probably damaging	Het
Fry	T	C	5: 150,426,218	Y1595H	probably damaging	Het
Fstl4	A	G	11: 53,072,429	N213D	probably benign	Het
Gab2	C	T	7: 97,301,438	P446L	probably damaging	Het
Ganab	A	T	19: 8,911,352	Y552F	possibly damaging	Het
Gfy	C	T	7: 45,177,538	R378Q	probably damaging	Het
Gm3285	T	C	10: 77,862,041	V8A	unknown	Het
Gm8251	G	A	1: 44,060,013	R642W	probably benign	Het
Gtf3c3	A	G	1: 54,403,593	L764P	probably damaging	Het
Igfbp2	A	T	1: 72,849,148	M150L	probably benign	Het
Jakmip2	C	T	18: 43,540,611	R796Q	probably damaging	Het
Jpt1	T	A	11: 115,498,195	R141W	probably damaging	Het
Junb	T	C	8: 84,978,173	E86G	probably damaging	Het
Lama2	T	C	10: 27,101,393	Y1930C	probably benign	Het
Med13	A	T	11: 86,271,002	I2167N	probably damaging	Het
Myo1b	A	C	1: 51,778,324	I593S	probably damaging	Het
Myo1c	A	T	11: 75,657,519	T16S	possibly damaging	Het
Ndufaf4	C	T	4: 24,901,829	L126F	probably damaging	Het
Nlrp9a	A	T	7: 26,557,296	N113I	possibly damaging	Het
Olfr1000	G	C	2: 85,608,184	S242C	probably damaging	Het
Olfr1173	T	A	2: 88,274,450	I200F	probably damaging	Het
Olfr478	T	A	7: 108,031,921	T141S	probably benign	Het
Pabpc6	A	T	17: 9,668,682	D313E	probably damaging	Het
Pcdhb2	G	T	18: 37,295,804	G277*	probably null	Het
Phkb	T	G	8: 86,029,597	V840G	probably damaging	Het
Pip4k2c	A	G	10: 127,199,086	F415S	probably damaging	Het
Ptprb	A	G	10: 116,343,874	E1112G	probably damaging	Het
Pum2	A	G	12: 8,747,206	D847G	probably damaging	Het
Qrich2	C	T	11: 116,455,624	R1458H	probably benign	Het
Rdh11	T	C	12: 79,185,183	Y199C	probably damaging	Het
Scamp3	A	G	3: 89,180,366	Y171C	probably damaging	Het
Serpinb9b	T	C	13: 33,039,760	S312P	probably damaging	Het
Slain2	G	A	5: 72,965,822	S461N	probably benign	Het
Slc23a1	G	A	18: 35,625,838	T100I	probably damaging	Het
Spata31d1b	T	A	13: 59,718,380	I1114N	probably damaging	Het
Spinkl	A	G	18: 44,174,589	S2P	probably damaging	Het
Srrt	T	C	5: 137,302,195	N173S	probably damaging	Het
Stk24	C	T	14: 121,302,287	A166T	probably damaging	Het
Supt16	A	T	14: 52,173,556	V697E	probably damaging	Het
Taf6l	C	T	19: 8,783,846	E53K	probably damaging	Het
Tmem81	A	T	1: 132,507,773	I106F	probably damaging	Het
Tnxb	C	A	17: 34,716,408	L2561I	probably damaging	Het
Top3b	G	A	16: 16,891,368	R640H	probably benign	Het
Trpm7	A	T	2: 126,810,165	S1463T	probably benign	Het
Ttll3	CAAAGTAA	CAAAGTAAAGTAA	6: 113,399,157		probably null	Het
Ttll3	AGTAAG	AGTAAGGTAAG	6: 113,399,160		probably null	Het
Ttll3	AA	AAAGTGA	6: 113,399,163		probably null	Het
Tubal3	A	C	13: 3,928,198	D38A	possibly damaging	Het
Vps13a	T	A	19: 16,647,598	I2766F	probably benign	Het
Wwc1	A	T	11: 35,844,195	V951E	possibly damaging	Het
Zfp777	A	T	6: 48,029,218	M414K	probably benign	Het

Other mutations in Klhl41

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01316:Klhl41	APN	2	69674724	missense	probably benign	0.00
IGL01622:Klhl41	APN	2	69678238	missense	probably benign	0.05
IGL01623:Klhl41	APN	2	69678238	missense	probably benign	0.05
IGL03237:Klhl41	APN	2	69670558	missense	possibly damaging	0.94
R0220:Klhl41	UTSW	2	69670485	missense	probably benign	0.25
R0277:Klhl41	UTSW	2	69671296	missense	probably damaging	1.00
R0456:Klhl41	UTSW	2	69670549	missense	probably damaging	0.99
R0485:Klhl41	UTSW	2	69671256	missense	probably damaging	0.97
R0536:Klhl41	UTSW	2	69670210	missense	probably benign	0.04
R0537:Klhl41	UTSW	2	69670210	missense	probably benign	0.04
R0552:Klhl41	UTSW	2	69670210	missense	probably benign	0.04
R0553:Klhl41	UTSW	2	69670210	missense	probably benign	0.04
R0834:Klhl41	UTSW	2	69678147	missense	possibly damaging	0.76
R0879:Klhl41	UTSW	2	69683483	unclassified	probably benign
R1531:Klhl41	UTSW	2	69670740	missense	probably benign	0.03
R1678:Klhl41	UTSW	2	69670939	missense	probably benign	0.01
R1792:Klhl41	UTSW	2	69670802	missense	probably benign	0.01
R1900:Klhl41	UTSW	2	69674619	splice site	probably benign
R2012:Klhl41	UTSW	2	69683496	missense	possibly damaging	0.61
R4041:Klhl41	UTSW	2	69670710	missense	probably benign	0.00
R5223:Klhl41	UTSW	2	69679827	nonsense	probably null
R5500:Klhl41	UTSW	2	69683529	missense	probably damaging	1.00
R5643:Klhl41	UTSW	2	69670471	missense	probably damaging	1.00
R5644:Klhl41	UTSW	2	69670471	missense	probably damaging	1.00
R5656:Klhl41	UTSW	2	69683532	missense	possibly damaging	0.89
R6264:Klhl41	UTSW	2	69679832	critical splice donor site	probably null
R6678:Klhl41	UTSW	2	69670844	missense	probably benign	0.04
R6731:Klhl41	UTSW	2	69674700	missense	probably damaging	1.00
R7664:Klhl41	UTSW	2	69670717	missense	probably damaging	1.00
X0021:Klhl41	UTSW	2	69679706	missense	probably damaging	1.00
Z1088:Klhl41	UTSW	2	69674730	missense	possibly damaging	0.65

Predicted Primers

PCR Primer
(F):5'- TTCTGTTCCACAAGCATGCC -3'
(R):5'- GACCCAAGTCCCATTTCAATATG -3'

Sequencing Primer
(F):5'- CATGCCTACAACAAATCCGTATTTTC -3'
(R):5'- GTCCCATTTCAATATGTAGGAAGGAG -3'

Posted On

2019-10-24